ID: 1044636993

View in Genome Browser
Species Human (GRCh38)
Location 8:94335381-94335403
Sequence AAGAATTATCTTAATTAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044636992_1044636993 12 Left 1044636992 8:94335346-94335368 CCATAATAAGGCTGCAATCTAAA No data
Right 1044636993 8:94335381-94335403 AAGAATTATCTTAATTAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044636993 Original CRISPR AAGAATTATCTTAATTAGCA TGG Intergenic
No off target data available for this crispr