ID: 1044646601

View in Genome Browser
Species Human (GRCh38)
Location 8:94449974-94449996
Sequence TAGTCCAGTCTGCTGAAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 132}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044646601 Original CRISPR TAGTCCAGTCTGCTGAAGAA GGG (reversed) Intronic
901341113 1:8500305-8500327 TAGTCCATTTTTCTCAAGAATGG - Intronic
903392319 1:22973055-22973077 TGCTCCAGGCTGGTGAAGAAAGG + Intergenic
903564002 1:24250763-24250785 TGGGTCAGTGTGCTGAAGAAGGG - Intergenic
908554490 1:65243965-65243987 TAGTCAAGTGTGGTGAAGGAGGG - Intergenic
909396286 1:75174284-75174306 AACCCCTGTCTGCTGAAGAAGGG + Intergenic
916214391 1:162383291-162383313 TACTCCAGACTGCTGAGGACAGG - Exonic
916935747 1:169626545-169626567 CACTCCAGCCTGCTGAAGATTGG + Intronic
917431562 1:174974852-174974874 CAGCCCAGTCTGCTGAGGACTGG - Intronic
919954289 1:202397257-202397279 CAGTCAAGTAAGCTGAAGAAAGG - Intronic
920224642 1:204429763-204429785 TGCTCCAGTCTGCAGAAGACAGG - Intronic
923633609 1:235673081-235673103 TAATCCAAACTGCTGAAAAAGGG + Intronic
924362491 1:243255765-243255787 TGGTCCAGGCAGCTGAAGAGTGG + Intergenic
1062867123 10:865199-865221 TAGTCCAGTGTTCTGGACAACGG + Intronic
1064469804 10:15624545-15624567 AAGTCCAGTCTGGTGAAGCCAGG - Intronic
1064649445 10:17493705-17493727 TAAACCAGACTGCTGAAGCAAGG + Intergenic
1065041039 10:21696480-21696502 TACTCCAGTCAGGTCAAGAATGG + Intronic
1066094404 10:32058414-32058436 TAGTCCAGTCTGATCAATGAAGG + Intergenic
1068601687 10:58963786-58963808 TAGCCCAGCCTGCTGAGGCAGGG - Intergenic
1071275122 10:84047100-84047122 TAGTGCAGCATGTTGAAGAACGG + Intergenic
1073739527 10:106390780-106390802 TAGTTCCGTCTGCCAAAGAAAGG - Intergenic
1074557815 10:114508054-114508076 GAGTCCAGACTGCTGAGCAACGG - Intronic
1076926218 10:133489333-133489355 TAAGCCAGTCTGCTGCAGCAGGG - Intergenic
1077866849 11:6229511-6229533 TACCTCAGTCAGCTGAAGAAAGG + Intronic
1079313447 11:19387417-19387439 TAGTTCAGGCTGCTGGAGCATGG + Intronic
1079497808 11:21065882-21065904 AAGTCCATTCTGATGAACAAGGG - Intronic
1080611337 11:33906595-33906617 TTTTCCCGTCTGCAGAAGAAAGG - Intergenic
1083164744 11:60876612-60876634 TTGTCCAGTATTCTGAAGACAGG - Intergenic
1085839127 11:79990319-79990341 GAGTCCAGTCTGCTCTAGCATGG + Intergenic
1090478444 11:127046353-127046375 CAGTCCATTCTACTAAAGAATGG + Intergenic
1091086194 11:132724180-132724202 TAGTGCACTGTGCTAAAGAAGGG - Intronic
1091127273 11:133111687-133111709 GAGCCCAGTCTGCTTAGGAAAGG - Intronic
1091372281 11:135070870-135070892 GAGTCCTGTCTGATGAGGAAGGG + Intergenic
1092493664 12:8970074-8970096 TAGCCCAGACTGGTGGAGAATGG - Intronic
1104041166 12:125132100-125132122 CTGTTCAGTCTGCTGTAGAAAGG + Intronic
1104430757 12:128714071-128714093 AAGTCCAGGCTGCAGATGAATGG - Intergenic
1106230347 13:27816636-27816658 TTTTCCAGTTTTCTGAAGAAGGG - Intergenic
1106241330 13:27916012-27916034 CAGTTCACTCTGCTGATGAAAGG - Intergenic
1108001915 13:45911603-45911625 GAGGCCAGTCTGCAGAAAAAGGG + Intergenic
1112924293 13:104655133-104655155 TAGTGCAGTCTAGTGTAGAAAGG - Intergenic
1113084896 13:106558883-106558905 TAGTCCATTGTGCTGAAGCAGGG + Intronic
1114062914 14:19037163-19037185 TAGTCCAGGGTGCAGCAGAACGG + Intergenic
1117313509 14:54551784-54551806 TACTCAAGTCAGCTTAAGAACGG + Intergenic
1118398771 14:65360482-65360504 TAGGCCAGTCCTCTGAAGTATGG - Intergenic
1121650324 14:95553325-95553347 CAGTCCATGCTCCTGAAGAAAGG + Intergenic
1126558919 15:50022276-50022298 TAGGCCAGTCTGGGGAACAAAGG - Intronic
1126950245 15:53872883-53872905 AAGTTCAGTTTGCTGAAGAAAGG - Intergenic
1129797886 15:78391896-78391918 TGGTCCTGTATGCTCAAGAATGG - Intergenic
1134889402 16:17825728-17825750 TAAAACACTCTGCTGAAGAAGGG + Intergenic
1135151139 16:20007051-20007073 TAGTTCAATCTGCTGGAGCAGGG + Intergenic
1135486932 16:22873925-22873947 CAGGCAAGCCTGCTGAAGAATGG - Intronic
1138173336 16:54873629-54873651 AAGTCCAGTTGGCTAAAGAAAGG + Intergenic
1138673067 16:58630642-58630664 TAGTTCTGTCTATTGAAGAAGGG + Intergenic
1141366287 16:83446542-83446564 AAGTCCATTCTGCTGAACAATGG + Intronic
1146494352 17:33307662-33307684 TAATCCTGTCTGCAGAAGCAAGG - Intronic
1147836282 17:43334316-43334338 TAGACCAGTCTGCTAAGTAACGG + Intergenic
1150143179 17:62746897-62746919 TGGTGCAGTCTGGGGAAGAAAGG - Intronic
1150261431 17:63795148-63795170 TAGTTCAGACTGTTGAAAAAAGG + Intronic
1157347911 18:46856786-46856808 TACTCCAGTCTTCTCAAGAAAGG - Intronic
1159043236 18:63344886-63344908 ATGTACAGTCTGGTGAAGAAAGG - Intronic
1162107312 19:8377813-8377835 GAGTCCAGTCTGCAGGAGAGGGG + Intronic
1166856899 19:45786717-45786739 CAGTACAGCCTGCTGAAGCAGGG - Exonic
1167373387 19:49098191-49098213 TAATCCAGGCTGCTGAGGAGAGG - Intronic
926216867 2:10911429-10911451 TAGTCCAGCCTCCTGTAGAAGGG - Intergenic
926542419 2:14197661-14197683 TAGTAAAGTCTGCTGTAGATAGG - Intergenic
927050357 2:19321873-19321895 TAACCCAGTCTTCTGAAGATTGG + Intergenic
927863390 2:26574252-26574274 AAGTTCAGTCTGCTGGAGAAGGG + Intronic
928657055 2:33463498-33463520 TTCTCCAGGATGCTGAAGAAAGG + Intronic
938857152 2:135325334-135325356 TGGTTCAGTTTGCTTAAGAAAGG - Intronic
940774590 2:157873644-157873666 TAGTCCAGTCTTCTGAGGGAGGG - Intronic
942086185 2:172445836-172445858 CATTCCAGGCAGCTGAAGAAAGG + Intronic
943081567 2:183263857-183263879 TAGCCTAATCTGGTGAAGAATGG - Intergenic
944916952 2:204370599-204370621 TAGTCCAGACAGTTGAAAAAAGG + Intergenic
945205038 2:207322755-207322777 CGGTCCATTCTGCAGAAGAAGGG - Intergenic
947620891 2:231590407-231590429 TAGTCCAGTCTGCTGGGGCCTGG + Intergenic
949045715 2:241871889-241871911 AAGACCAGCCTGCTGAGGAAGGG - Exonic
1168874916 20:1164765-1164787 TACCCAAGACTGCTGAAGAAAGG - Intronic
1174861344 20:54094419-54094441 AAGTCCCATCTTCTGAAGAAAGG + Intergenic
1174872687 20:54198178-54198200 CAGTGCCATCTGCTGAAGAAAGG + Intergenic
1177220152 21:18181957-18181979 TATTCCCATCAGCTGAAGAATGG - Intronic
949471560 3:4401898-4401920 TACTTCAGTGTGCTCAAGAAAGG - Intronic
951944139 3:28115038-28115060 TAGCCCAGCCTGCTAAAGGATGG - Intergenic
952378392 3:32785582-32785604 TACTCCAGCCTGGTGAAGAGAGG + Intergenic
956357210 3:68407129-68407151 TAGTCCATACTGGTGAAAAAAGG + Intronic
961111939 3:124291772-124291794 AAATCCAGTCTGCTCAAGGAAGG - Intronic
966030388 3:175339116-175339138 TCCTCAAGTCTGCTGAAGAATGG - Intronic
966876114 3:184322724-184322746 AAGTCAGGTATGCTGAAGAAAGG + Exonic
967618873 3:191607377-191607399 TTATCCAGTCTGCTGCAGATGGG - Intergenic
974168555 4:58236076-58236098 CAGTCCAGTCTATTGATGAATGG - Intergenic
978016529 4:103752797-103752819 TATTACAGCCTGTTGAAGAATGG + Intergenic
978718785 4:111879229-111879251 TAGTTGTGTCTACTGAAGAAAGG - Intergenic
979178250 4:117692114-117692136 CAGTCCAGTCTTGTGAAGGAAGG - Intergenic
985106356 4:186503905-186503927 TCATCCAGTCAGTTGAAGAAGGG - Intronic
987033314 5:13995824-13995846 CAGTCAACTCTGCTGAAGGAAGG - Intergenic
988334461 5:29887854-29887876 CATACCAGTCTGCTTAAGAATGG - Intergenic
988447615 5:31305315-31305337 TAGGCCAGTTTGCTGAAGACAGG - Exonic
989593411 5:43133050-43133072 TGGTTCAGTCTGCTAATGAAAGG - Intronic
993905935 5:93622628-93622650 GAGGCCAGTCTGCAGAGGAAAGG - Intronic
995369070 5:111398303-111398325 TAGTCCAGTCAGCTGTGGATGGG + Intronic
999948630 5:156624659-156624681 TAGTCCTGTCTTCTGAATGAGGG + Intronic
1000089242 5:157915838-157915860 CAGGCCAGGCTGCTGGAGAATGG + Intergenic
1000292028 5:159879445-159879467 TAGTCCTGGCTGCTGGAGAGGGG - Intergenic
1000552699 5:162686693-162686715 TGGTCCAATCTTCTGGAGAAAGG + Intergenic
1003682291 6:8268034-8268056 AAGTCCAGTCTGCTGAACATGGG + Intergenic
1004839887 6:19570768-19570790 TATTACAGGCTGCTGAAAAAGGG - Intergenic
1006989877 6:38206027-38206049 TAGTCCAGACTGCAGAGGGAAGG + Intronic
1007267035 6:40604320-40604342 TAGACCAGGCTGCTGAAGGTTGG + Intergenic
1011346553 6:86375877-86375899 GATCCCAGTCTTCTGAAGAAAGG - Intergenic
1012595338 6:101031973-101031995 GAGTACAGACTGCAGAAGAATGG - Intergenic
1013205585 6:107942301-107942323 TAATACTGGCTGCTGAAGAATGG - Intronic
1018700244 6:166420569-166420591 TTGTCCAGCCTGCAGAAGGAAGG - Intronic
1021942575 7:25693371-25693393 TACTTCAGTGTGCAGAAGAAGGG + Intergenic
1023319559 7:38978593-38978615 TAGTCTTGGCTGCTGCAGAAGGG + Intronic
1023365261 7:39457533-39457555 TAGTGAAGCCTGCTGAATAATGG + Intronic
1026697340 7:72606675-72606697 TATACCATTCTGATGAAGAAGGG - Intronic
1028765970 7:94560171-94560193 TAGTCTAGTCTTATGAAGGAAGG - Intergenic
1029248719 7:99221023-99221045 CAGTCCAGGCTGCTGAAGACAGG - Intergenic
1030311532 7:108073890-108073912 GAGTGCAGTTTTCTGAAGAAGGG - Intronic
1037657126 8:20894363-20894385 GGGTCCAGTCTTCTGTAGAAAGG - Intergenic
1039279377 8:35966837-35966859 TTGTACAGTGTGCTGAAGTAGGG - Intergenic
1041142149 8:54833209-54833231 CAGTCTAATCTTCTGAAGAATGG - Intergenic
1043331432 8:79122396-79122418 AAGTCCAAACTGCTGAAAAAGGG + Intergenic
1043679689 8:83007560-83007582 AGGTCCAGTCTCCTAAAGAATGG - Intergenic
1044646601 8:94449974-94449996 TAGTCCAGTCTGCTGAAGAAGGG - Intronic
1046048673 8:108994117-108994139 TTGTCCAGACTGGTGAGGAATGG - Intergenic
1048982159 8:139708424-139708446 TAGTCCAGTCTGCAGGGGCAGGG - Intergenic
1055887110 9:81076488-81076510 TAATCTTGTCTGCTGAAGCAAGG + Intergenic
1057101048 9:92360363-92360385 TAGTCCAGTCTGAGCAACAAAGG + Intronic
1058601001 9:106670166-106670188 CTGTGCAGTCTGCAGAAGAAAGG + Intergenic
1187631864 X:21182025-21182047 TAGTCCAGTCAGCTGATGCCAGG + Intergenic
1188944738 X:36285492-36285514 TTGTCAAGACAGCTGAAGAAAGG - Intronic
1190976323 X:55405227-55405249 TAGAGCAGTCTGCTGCAGAAAGG + Intergenic
1193350478 X:80457847-80457869 TGGTGCAGCCTGCTGAGGAATGG - Intergenic
1193521234 X:82531435-82531457 TAGTCCAATTTGCTGGAGTAGGG - Intergenic
1194094264 X:89618049-89618071 TAATCCTGTCTTTTGAAGAATGG - Intergenic
1196062741 X:111428813-111428835 TTGTCCAGTCTGTGCAAGAAAGG + Intergenic
1197323030 X:125056912-125056934 GAGTCAAGTCTGTTGAAGACAGG - Intergenic
1199384371 X:147206899-147206921 TTGTTCAGTCTGCTCCAGAAAGG + Intergenic
1200446899 Y:3274229-3274251 TAATCCTGTCTTTTGAAGAATGG - Intergenic
1201856841 Y:18553726-18553748 AAAGCCAGTCTGCTGCAGAAAGG - Intronic
1201876480 Y:18766654-18766676 AAAGCCAGTCTGCTGCAGAAAGG + Intronic
1202170416 Y:22037850-22037872 AAAGCCAGTCTGCTAAAGAAAGG + Intergenic
1202220948 Y:22548523-22548545 AAAGCCAGTCTGCTAAAGAAAGG - Intergenic
1202322164 Y:23647140-23647162 AAAGCCAGTCTGCTAAAGAAAGG + Intergenic
1202548604 Y:26022916-26022938 AAAGCCAGTCTGCTAAAGAAAGG - Intergenic
1202580335 Y:26374067-26374089 CAGTCAAGTAAGCTGAAGAAAGG + Intergenic