ID: 1044648191

View in Genome Browser
Species Human (GRCh38)
Location 8:94467048-94467070
Sequence TGGAGTATCAGCTACTCGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 286121
Summary {0: 1, 1: 28, 2: 2697, 3: 72485, 4: 210910}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044648191_1044648202 27 Left 1044648191 8:94467048-94467070 CCTCCCGAGTAGCTGATACTCCA 0: 1
1: 28
2: 2697
3: 72485
4: 210910
Right 1044648202 8:94467098-94467120 TTTTATTTTTTGTAGAGACAGGG 0: 1209
1: 9840
2: 93675
3: 221670
4: 257459
1044648191_1044648201 26 Left 1044648191 8:94467048-94467070 CCTCCCGAGTAGCTGATACTCCA 0: 1
1: 28
2: 2697
3: 72485
4: 210910
Right 1044648201 8:94467097-94467119 TTTTTATTTTTTGTAGAGACAGG 0: 1205
1: 14690
2: 212366
3: 268082
4: 182877

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044648191 Original CRISPR TGGAGTATCAGCTACTCGGG AGG (reversed) Intronic
Too many off-targets to display for this crispr