ID: 1044661534

View in Genome Browser
Species Human (GRCh38)
Location 8:94596140-94596162
Sequence ATTCAGATTCAGAAGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044661528_1044661534 18 Left 1044661528 8:94596099-94596121 CCTTAAACAAACTAAAATGTTTT No data
Right 1044661534 8:94596140-94596162 ATTCAGATTCAGAAGGTGGAAGG No data
1044661529_1044661534 -9 Left 1044661529 8:94596126-94596148 CCCAGCCTTCTAACATTCAGATT No data
Right 1044661534 8:94596140-94596162 ATTCAGATTCAGAAGGTGGAAGG No data
1044661530_1044661534 -10 Left 1044661530 8:94596127-94596149 CCAGCCTTCTAACATTCAGATTC No data
Right 1044661534 8:94596140-94596162 ATTCAGATTCAGAAGGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044661534 Original CRISPR ATTCAGATTCAGAAGGTGGA AGG Intergenic
No off target data available for this crispr