ID: 1044662076

View in Genome Browser
Species Human (GRCh38)
Location 8:94601130-94601152
Sequence TACCCTCTCCTTCTTCCGAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044662076_1044662077 18 Left 1044662076 8:94601130-94601152 CCGCTCGGAAGAAGGAGAGGGTA No data
Right 1044662077 8:94601171-94601193 TTGAGCCTTGAAAACATATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044662076 Original CRISPR TACCCTCTCCTTCTTCCGAG CGG (reversed) Intergenic
No off target data available for this crispr