ID: 1044673672

View in Genome Browser
Species Human (GRCh38)
Location 8:94708933-94708955
Sequence GCCATGAATTCATAGGTTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 271
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 248}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044673665_1044673672 25 Left 1044673665 8:94708885-94708907 CCACCGCGCCCAGTCGACGTCCC No data
Right 1044673672 8:94708933-94708955 GCCATGAATTCATAGGTTCCAGG 0: 1
1: 0
2: 0
3: 22
4: 248
1044673667_1044673672 17 Left 1044673667 8:94708893-94708915 CCCAGTCGACGTCCCACTTTTTT No data
Right 1044673672 8:94708933-94708955 GCCATGAATTCATAGGTTCCAGG 0: 1
1: 0
2: 0
3: 22
4: 248
1044673669_1044673672 5 Left 1044673669 8:94708905-94708927 CCCACTTTTTTACATCTGTTACT No data
Right 1044673672 8:94708933-94708955 GCCATGAATTCATAGGTTCCAGG 0: 1
1: 0
2: 0
3: 22
4: 248
1044673670_1044673672 4 Left 1044673670 8:94708906-94708928 CCACTTTTTTACATCTGTTACTA No data
Right 1044673672 8:94708933-94708955 GCCATGAATTCATAGGTTCCAGG 0: 1
1: 0
2: 0
3: 22
4: 248
1044673668_1044673672 16 Left 1044673668 8:94708894-94708916 CCAGTCGACGTCCCACTTTTTTA No data
Right 1044673672 8:94708933-94708955 GCCATGAATTCATAGGTTCCAGG 0: 1
1: 0
2: 0
3: 22
4: 248
1044673666_1044673672 22 Left 1044673666 8:94708888-94708910 CCGCGCCCAGTCGACGTCCCACT No data
Right 1044673672 8:94708933-94708955 GCCATGAATTCATAGGTTCCAGG 0: 1
1: 0
2: 0
3: 22
4: 248

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044673672 Original CRISPR GCCATGAATTCATAGGTTCC AGG Intergenic
901378165 1:8854633-8854655 GCCCTGAATTCATGAGTACCTGG + Intergenic
901558952 1:10054444-10054466 GCCATGAATTCATAGGTAATAGG + Intronic
903094561 1:20957930-20957952 GCCATGAATCCATCTGGTCCAGG - Intronic
905098835 1:35500358-35500380 GCCAACAATTCAGAGGTTCATGG + Intronic
906172103 1:43735228-43735250 GTAACAAATTCATAGGTTCCAGG - Intronic
907866234 1:58402108-58402130 GCCCTGCATTCATATGCTCCTGG + Intronic
910331315 1:86075424-86075446 GCTATGAATTCATCTGGTCCTGG - Intronic
910971987 1:92865278-92865300 GCCTTGAATTCCTGGGATCCAGG - Intronic
911132692 1:94406398-94406420 GCCATGAATTCATAGGGAATAGG + Intergenic
911170073 1:94762001-94762023 GCTATGAATCCATCTGTTCCTGG - Intergenic
911458260 1:98155143-98155165 GCCATGAATCCATCTGGTCCTGG - Intergenic
912890422 1:113524036-113524058 GCCATGGCTTCAGAGGTTGCAGG + Intronic
913142315 1:115953812-115953834 GCTGTGTACTCATAGGTTCCAGG - Intergenic
915651855 1:157318814-157318836 GCTATGAATCCATATGGTCCTGG - Intergenic
916389591 1:164316972-164316994 GCCATGAATTCTTATGCTCCTGG + Intergenic
916533056 1:165676759-165676781 GCCATGAATTCATAGGGAATAGG - Intronic
917461864 1:175238008-175238030 GCCGTGAATTCATCTGGTCCTGG - Intergenic
917532673 1:175851051-175851073 GCCTTGACTTCCTAGGTTCAAGG + Intergenic
918166941 1:181958707-181958729 GCCATGAATCCATCTGGTCCTGG + Intergenic
918854127 1:189729093-189729115 GCCACGAATTCATCTGTTTCTGG + Intergenic
919453274 1:197795856-197795878 GCTGTGAATTCATCTGTTCCTGG + Intergenic
919500426 1:198331169-198331191 GCCATGCATGCATAAGTTCCAGG + Intergenic
920213656 1:204346780-204346802 GCCATGAATTCATAGGGAATAGG + Intronic
920625344 1:207591976-207591998 GCTATGAATCCATCTGTTCCTGG - Intronic
921057429 1:211553886-211553908 GCCTTGAACTCAGAGGTTCAAGG + Intergenic
921112385 1:212051528-212051550 GCCATGAATTCATAGGGAATAGG + Intronic
923397109 1:233577187-233577209 GGCATTAACTCACAGGTTCCAGG + Intergenic
1064181644 10:13121605-13121627 GTCATCACTTCAGAGGTTCCTGG + Intronic
1065752394 10:28899006-28899028 GCCATGAATTCATAGGGAATAGG + Intergenic
1067350407 10:45470581-45470603 GCAATGCATTCCCAGGTTCCAGG + Intronic
1069376062 10:67794224-67794246 GCCATGAATTCATAGGGAATAGG - Intergenic
1070244220 10:74715368-74715390 GCCATGAAGTCATCTGATCCTGG + Intergenic
1070654242 10:78260379-78260401 GACATAAATCCATAGGTTCCAGG + Intergenic
1071065098 10:81622701-81622723 GCAATGAAGCCATAGGTTCTGGG + Intergenic
1071172522 10:82883409-82883431 GTCATGAAGTCATAGATTCCTGG + Intronic
1071363018 10:84869772-84869794 GCCATGAATCCATGTGGTCCAGG - Intergenic
1072381942 10:94881792-94881814 GCCATCATTTCATGGCTTCCAGG - Intergenic
1075195497 10:120354705-120354727 GCCATGAATTCATAGGGAATAGG + Intergenic
1075353209 10:121744940-121744962 GCCATGAAGTCCAACGTTCCAGG - Intronic
1075448582 10:122531025-122531047 GTCATATATTCACAGGTTCCAGG - Intergenic
1078163962 11:8866721-8866743 GCCATTTATTCAGAAGTTCCTGG - Intronic
1078256166 11:9660894-9660916 GCCATGAATTCATAGGAAATAGG - Intergenic
1079462208 11:20691894-20691916 GCCATGAATCCATCGGGTCCTGG + Intronic
1079550828 11:21695138-21695160 GCCTTGAATTCATCTGGTCCTGG + Intergenic
1079896365 11:26124164-26124186 TTCATAAATTCATAAGTTCCAGG - Intergenic
1080280197 11:30548294-30548316 GCCTTGAACTCCTGGGTTCCAGG + Intronic
1081216151 11:40401059-40401081 GGCATGAATTAATAAGCTCCTGG + Intronic
1082912437 11:58391462-58391484 GCAACATATTCATAGGTTCCAGG + Intergenic
1086283506 11:85218755-85218777 CACATGAACTCATATGTTCCTGG + Intronic
1087358856 11:97131677-97131699 GCAATGAAGCCATAGGGTCCTGG + Intergenic
1087381479 11:97409387-97409409 CCCATGAATACCTAGGTCCCAGG + Intergenic
1089199111 11:116712765-116712787 GTAACGTATTCATAGGTTCCAGG - Intergenic
1089526168 11:119098192-119098214 GCCCTGAATTCATCTATTCCTGG + Intronic
1091764239 12:3107813-3107835 GGCATGAATTCATTTTTTCCTGG + Intronic
1092800071 12:12155746-12155768 GCCATGAATTCATAGGGAATAGG - Intronic
1093658719 12:21727917-21727939 GCCAGGGATTCATAGGCACCGGG - Intronic
1096348174 12:50869530-50869552 GCCATGAATCCATCTGATCCTGG - Intronic
1098057629 12:66525061-66525083 GCTGTGAATTCATCTGTTCCTGG - Intronic
1098322267 12:69258078-69258100 GCCATGGAATCCTAGTTTCCAGG - Intronic
1103642777 12:122365606-122365628 GCCATGAATTCATAGGGAATAGG - Intronic
1104273010 12:127299577-127299599 GAAATGAATTCATAGATTCCAGG - Intergenic
1106117561 13:26830495-26830517 GCCATGAAATCAAGGGATCCTGG + Intergenic
1106167003 13:27256499-27256521 GCCATGAATTCATAGGGAATAGG - Exonic
1110427751 13:75388271-75388293 GTAATATATTCATAGGTTCCTGG + Intronic
1110621829 13:77605346-77605368 GCCTTGAATTCATTGGGTCGCGG - Intronic
1110664266 13:78097894-78097916 GCCATGAATTCTTCTGGTCCTGG - Intergenic
1117506369 14:56407211-56407233 GCCATGAATCCATCTGGTCCTGG - Intergenic
1120675139 14:87413208-87413230 GACATAGATTCACAGGTTCCAGG - Intergenic
1120682606 14:87498644-87498666 TCCATGAAGACAGAGGTTCCTGG + Intergenic
1121774218 14:96579741-96579763 TCTCTGAATTCTTAGGTTCCAGG - Intergenic
1125448602 15:39784310-39784332 GCCATGAAAGCCTATGTTCCTGG + Intergenic
1127444734 15:59049400-59049422 GCCATGAATTCACAGGTTATAGG + Intronic
1127497342 15:59525420-59525442 GCCATAAATTCATAGGGAACAGG + Intergenic
1127500811 15:59552616-59552638 GCCATGAATTCATAGGGAAGAGG + Intergenic
1127875785 15:63110236-63110258 GAAATGTATTCACAGGTTCCAGG - Intergenic
1129360708 15:75022144-75022166 TCAATGAATACAGAGGTTCCTGG + Intergenic
1129861199 15:78863251-78863273 GCCATGAATTCATAGGGAATAGG + Intronic
1132096760 15:98991489-98991511 GCCATGAATCCATCTGGTCCTGG - Intronic
1133831937 16:9331393-9331415 GGGATGATTTCAAAGGTTCCTGG - Intergenic
1135119482 16:19753341-19753363 GCCTTGAATTCCTAGGCTCAAGG - Intronic
1138123362 16:54418675-54418697 GCCCTGAGTTCATAGGTTTGAGG - Intergenic
1139434752 16:66929846-66929868 GCCTTGAATGCCTGGGTTCCAGG - Intergenic
1140423010 16:74836178-74836200 GACATGAATTCACAGGTTGCTGG + Intergenic
1140608321 16:76567586-76567608 GGCATGTATTCACAGGTTGCAGG + Intronic
1141113052 16:81286103-81286125 GTCTTGAATTCCTAGGTTCAGGG + Intronic
1141769355 16:86079819-86079841 GCCACTTATTCCTAGGTTCCAGG - Intergenic
1142772788 17:2111619-2111641 GCCTTGAACTCCTAGGTTCAAGG + Intronic
1142979907 17:3665676-3665698 GCCATGAATTCATAGGGAATAGG - Intronic
1144696015 17:17304239-17304261 TCCATGAAAGCATAGCTTCCAGG + Intronic
1146283975 17:31561976-31561998 CTCTTGAATTCATAGTTTCCTGG + Intergenic
1147800190 17:43079754-43079776 GCCATGAATTCATAGGGAATAGG - Intronic
1148159486 17:45441922-45441944 CCCATCACTTCATCGGTTCCAGG - Intronic
1148669560 17:49400433-49400455 GCTATGAATTCATAGGGAACAGG + Intronic
1148947363 17:51275457-51275479 GCCATGAATGCAAAGATGCCAGG + Intronic
1149328501 17:55557333-55557355 GCTATGAATCCATCGGGTCCTGG + Intergenic
1149492004 17:57091769-57091791 GCCTTGAATTCCTGGGTTCAAGG + Intronic
1150390822 17:64789009-64789031 CCCATCACTTCATCGGTTCCAGG - Intergenic
1150655242 17:67034868-67034890 GCCACATATTCACAGGTTCCAGG - Intergenic
1150895992 17:69211589-69211611 GCTATGAATCCATCTGTTCCTGG + Intronic
1152263846 17:79282041-79282063 GACATGAATTCAGAGGTTGTTGG + Intronic
1155731170 18:29160574-29160596 GCCAAGAATTTACAGGTTCTTGG - Intergenic
1156304766 18:35867175-35867197 GCCATGAATCCATCTGGTCCTGG - Intergenic
1156699749 18:39811588-39811610 GCTATGAATTCATCTGGTCCTGG + Intergenic
1157736746 18:50056300-50056322 GCCAAGAATTGATATTTTCCAGG - Intronic
1158145412 18:54306684-54306706 GCTGTGAATTCATCTGTTCCTGG + Intronic
1159346350 18:67211616-67211638 TCCATGAATTCTTAGGTTCTTGG - Intergenic
1167339648 19:48907631-48907653 GTCACGCATTCACAGGTTCCGGG + Intronic
925802899 2:7619024-7619046 GCCATGTAATCAATGGTTCCTGG - Intergenic
925933199 2:8727447-8727469 GCCAGGAATTCAGAGATTCCTGG + Intronic
926494893 2:13574202-13574224 GAAATAAATTCATAGCTTCCAGG + Intergenic
928020484 2:27700921-27700943 GCCTCGAATTCATAGGCTCAAGG + Intergenic
932215699 2:69964593-69964615 ACCATGATTTCCTAGGTTCTGGG - Intergenic
932980418 2:76658616-76658638 GCTATGAAATGATAGGTTCTTGG + Intergenic
940580440 2:155572830-155572852 GCTGTGAATCCATATGTTCCTGG + Intergenic
941994385 2:171587548-171587570 GCCATGAATTCATAGGGAATAGG - Intergenic
945845178 2:214935712-214935734 GCCTTGAACTCCTGGGTTCCAGG - Intronic
946052874 2:216878740-216878762 CCCATGAGGTCATAGGTTCCTGG + Intergenic
946649744 2:221878589-221878611 GCCATGAATTCATCTGGTCCAGG + Intergenic
947188498 2:227475902-227475924 GCTATGTATTCATATTTTCCAGG - Intronic
947504949 2:230701015-230701037 GTCACGTATTCACAGGTTCCAGG + Intergenic
947949508 2:234135244-234135266 GCCATCAGTTTAAAGGTTCCTGG + Intergenic
948725654 2:239932251-239932273 GCAATGAATTAATAGATTCTTGG - Intronic
1169554162 20:6731991-6732013 GCCAGGGATTCATAGGGTCATGG + Intergenic
1171198282 20:23219756-23219778 GCTATGAATTCATCTGGTCCTGG + Intergenic
1171443222 20:25183439-25183461 GCCTTGAATCCATCTGTTCCTGG + Intergenic
1172408578 20:34706409-34706431 TCCATGAATTAGTAGGTTCTTGG + Intronic
1179167096 21:38943852-38943874 TTCATGTATTCATGGGTTCCGGG - Intergenic
1179836835 21:44040553-44040575 GTCTTGAATTCCTAGGTTCAAGG + Intronic
1180040160 21:45273413-45273435 GCTGTGAATTCATTGGGTCCTGG - Intronic
1180577781 22:16796238-16796260 GCTATGAATTCATCTGCTCCAGG - Intronic
1181965599 22:26654607-26654629 GCCTTGAACTCTTAGGTTCAAGG - Intergenic
951309970 3:21113271-21113293 GCCATGAAACCATTGGGTCCTGG + Intergenic
951406853 3:22311836-22311858 GCCATGAAATCAGAGTTTCTAGG + Intronic
952098301 3:29982034-29982056 GCCATGAATCCATCTGCTCCTGG + Intronic
952292428 3:32030652-32030674 GCCATGAATTCATAGGGAATAGG - Intronic
952853520 3:37748877-37748899 GCCATGAATTCATAGGGAACAGG - Intronic
954596536 3:51830075-51830097 GCCATAAATGCAGAGGTTCATGG + Intronic
955472165 3:59297293-59297315 GCCATGAATCCATGTGGTCCTGG - Intergenic
956194414 3:66637519-66637541 GCCATCAATTCATAGGGACTAGG - Intergenic
956303672 3:67800690-67800712 GCTATGAATTCATCTGTTCCTGG + Intergenic
957966439 3:87327391-87327413 GCAATAAAGTCATAGGGTCCTGG - Intergenic
957974140 3:87421350-87421372 TCCAAGAAATCAGAGGTTCCAGG + Intergenic
959009459 3:101058167-101058189 GCCATGAATCCATCTGGTCCTGG + Intergenic
962587068 3:136852424-136852446 GCCAAAAACTCATCGGTTCCAGG - Intronic
963450785 3:145479607-145479629 GCTGTGAATTCATATGATCCTGG + Intergenic
963592348 3:147277226-147277248 GCCATGAATTCATAGGGAATAGG - Intergenic
964192778 3:154024272-154024294 GCCATGAATTCATAGGGAATAGG - Intergenic
964384099 3:156128831-156128853 GCCATGAATTTATAGATTTTAGG - Intronic
965016526 3:163165581-163165603 GCCATGAATCCATTGGGCCCTGG + Intergenic
968250449 3:197206069-197206091 GCCATGTATTCACAGGTTCAAGG + Intronic
968634780 4:1672296-1672318 TCCATGGGTTCATGGGTTCCTGG - Intronic
970787260 4:19814205-19814227 GCCATGAATTCATAGGGAATAGG - Intergenic
971879050 4:32344715-32344737 GCAATGAAATGATAGGTTGCAGG + Intergenic
976619410 4:87113157-87113179 GGCATAAAAACATAGGTTCCTGG - Intronic
977548118 4:98409737-98409759 GCCATGAATTCATAGGGAAGAGG - Intronic
977723232 4:100265141-100265163 GCCATGAATCCATCTGGTCCTGG + Intergenic
977922711 4:102663051-102663073 GCCATGCATTCATAGGGAACAGG - Intronic
978718647 4:111877239-111877261 GACTTTAATTCATAGGTTCAAGG - Intergenic
978890378 4:113819323-113819345 GCGATGAATCCATAAGGTCCTGG + Intergenic
979174616 4:117647999-117648021 GCTGTGAATTCATGTGTTCCAGG + Intergenic
979886462 4:126033478-126033500 GCCATGAATCCATCTGGTCCTGG - Intergenic
980029657 4:127812722-127812744 GCCATGAATTCATAGGGAATAGG + Intronic
980323095 4:131304599-131304621 GCCATGAATACATCTGGTCCTGG - Intergenic
982039182 4:151378458-151378480 GCTATGAATTCATTTGGTCCTGG - Intergenic
983217118 4:165012370-165012392 GCCATGAATTCATAGGGAATAGG + Intergenic
983470187 4:168145751-168145773 TCCCTGAATTCAGCGGTTCCTGG - Intronic
984166958 4:176314176-176314198 CTCATGAATTCATAGCTGCCTGG - Intergenic
984737287 4:183121618-183121640 GGCATAAATTCATGGGTTACTGG - Intronic
986108190 5:4681350-4681372 CCAATGAAGTCATAGGGTCCTGG - Intergenic
987651949 5:20752553-20752575 GTAATGTATTCACAGGTTCCTGG + Intergenic
988507961 5:31840496-31840518 GCCATGAATTCATAGGGAATGGG + Intronic
988672039 5:33392215-33392237 GCCATGAATCCATCTGGTCCTGG - Intergenic
988743614 5:34108925-34108947 GTAATGTATTCACAGGTTCCTGG - Intronic
990720154 5:58685541-58685563 ACCACATATTCATAGGTTCCAGG + Intronic
992643012 5:78785723-78785745 GTGATGTATTCATAGGTTCTGGG - Intronic
993365733 5:87031824-87031846 GCCATGAATCCATCTGGTCCTGG + Intergenic
993492768 5:88571953-88571975 GTCATATATTCACAGGTTCCAGG + Intergenic
995211211 5:109541531-109541553 GCTATGAATCCATCTGTTCCTGG - Intergenic
995696765 5:114886903-114886925 GCTATGAATCCATATGGTCCAGG + Intergenic
996198111 5:120635147-120635169 GCCATGAATTCATCTGGTCCTGG - Intronic
996244362 5:121242206-121242228 GCCATGAATCCATATTGTCCTGG - Intergenic
996409450 5:123142240-123142262 GTCATCAATTCATAGGGTCATGG + Intronic
996957171 5:129197284-129197306 GTCATGTATTTATAGGTTCTAGG - Intergenic
997097255 5:130927080-130927102 GCTATGAATCCATCTGTTCCTGG - Intergenic
1000533769 5:162456007-162456029 GCCATGATTGCATAGAATCCAGG - Intergenic
1001192327 5:169642631-169642653 GCCACCAATTCTTAGGTGCCGGG + Intronic
1002154387 5:177265215-177265237 GCCATGAATTCATAGGGAATAGG - Intronic
1002849079 6:976162-976184 GCCATGAATCCATCTGGTCCTGG + Intergenic
1002894488 6:1368693-1368715 GCCAAAACTTCACAGGTTCCAGG + Intergenic
1004800719 6:19144137-19144159 GCCATGAATTCATAGGGAAGAGG - Intergenic
1005796069 6:29363331-29363353 GCCATGAATCCATCAGATCCTGG - Intronic
1006209037 6:32376836-32376858 GTCTTGAATTCCTAGGTTCAAGG - Intergenic
1009292021 6:61894313-61894335 GCCATGTATTCAGAGATTTCTGG - Intronic
1009929190 6:70156202-70156224 GCCATGGAATCATACTTTCCAGG - Exonic
1010610481 6:77948827-77948849 GCCATGAATTCATCTGGTACAGG - Intergenic
1011187669 6:84696891-84696913 GCAATGAATTCAGGGCTTCCCGG + Intronic
1011305521 6:85922019-85922041 GCCATGCACTCATAGGTCACTGG + Intergenic
1011884932 6:92081827-92081849 GCTATGAATTCATCTGGTCCTGG - Intergenic
1014243957 6:119047758-119047780 GCCGTGAATCCATATGATCCTGG - Intronic
1016061164 6:139632098-139632120 GCAATGAATCCATTGGGTCCTGG + Intergenic
1017358015 6:153532946-153532968 GCCATGAATCCATCTGGTCCAGG + Intergenic
1018151910 6:160947472-160947494 GCCTTGAACTCCTAGGTTCAAGG - Intergenic
1018321591 6:162616049-162616071 GCCATGAGTTAGGAGGTTCCTGG - Intronic
1018597047 6:165492238-165492260 GCCATGAATCCATTTGGTCCTGG - Intronic
1018680006 6:166256776-166256798 GCCATGAACCCCTAGGCTCCTGG + Intergenic
1021050131 7:15972992-15973014 GCCATCAATGCACAGATTCCTGG + Intergenic
1021383819 7:20003221-20003243 GCCATGAATTCATAGGGAATAGG - Intergenic
1024923240 7:54583374-54583396 GCCAGGAATTCATGGGTACAGGG + Intergenic
1026248153 7:68641558-68641580 GCCATGAATTCATAGGGAATAGG - Intergenic
1027744628 7:82057741-82057763 ACCATGGATTCATAGGCCCCAGG + Intronic
1028168149 7:87563194-87563216 GCCATGAATTCATCTGGTCCTGG - Intronic
1030318175 7:108137609-108137631 GTCATATATTCACAGGTTCCAGG + Intergenic
1031295196 7:119993135-119993157 GCCATGAATCCATCTGTTCCTGG - Intergenic
1032663201 7:134008723-134008745 GCCTTGAATTCCTAGGCTCAAGG + Intronic
1032978247 7:137250597-137250619 GCCATGAATTCATACATACAAGG - Intronic
1034328190 7:150257356-150257378 GCCATGCATTCATATGTCCCTGG - Intronic
1034765026 7:153712108-153712130 GCCATGCATTCATATGTCCCTGG + Intergenic
1035958486 8:4110312-4110334 GCCAAAAATTCACAAGTTCCTGG - Intronic
1038527952 8:28293077-28293099 GCCTTGAATTCCTGGGCTCCAGG - Intergenic
1039102387 8:33954682-33954704 GCCATGAATTCTTCTGGTCCTGG + Intergenic
1039181767 8:34874609-34874631 GCCATGAATTCATAGGGAATAGG - Intergenic
1039320695 8:36427288-36427310 TCCATACATTCATAGATTCCAGG - Intergenic
1041191394 8:55359000-55359022 CCCATTTATTCATAGATTCCTGG + Intronic
1042779824 8:72479068-72479090 GCTATGAATCCATATGGTCCAGG - Intergenic
1043461760 8:80467623-80467645 GCCATGATTTGGAAGGTTCCTGG + Intergenic
1043594453 8:81867626-81867648 GCTATGAATTCATCTGGTCCAGG - Intergenic
1044673672 8:94708933-94708955 GCCATGAATTCATAGGTTCCAGG + Intergenic
1045786072 8:105922060-105922082 GCCATGAATCCATTTGGTCCAGG - Intergenic
1047148100 8:122228851-122228873 GCTATGAATTCATCTGGTCCTGG - Intergenic
1047286866 8:123494573-123494595 GCAACATATTCATAGGTTCCAGG + Intergenic
1048109552 8:131453395-131453417 GCCAGGATTCCAGAGGTTCCTGG - Intergenic
1048509128 8:135046557-135046579 GCCCTGAATTCAAAAGATCCAGG - Intergenic
1050099583 9:2104663-2104685 GACATGACTTCATTGTTTCCTGG + Intronic
1050878464 9:10670878-10670900 GCTATGAATTCATCTGGTCCTGG + Intergenic
1051103438 9:13549529-13549551 GACATGAATCCTTAGGTTCAAGG + Intergenic
1052546979 9:29892135-29892157 GCTATGAATTCATCTGGTCCTGG - Intergenic
1053361520 9:37490425-37490447 GCCATGAATTCATAGGGAATAGG + Intronic
1055256020 9:74372305-74372327 GGCATAAATTCAGAGGATCCAGG + Intergenic
1055257736 9:74392283-74392305 GCCATCAAGACATAGGTTCTAGG - Intergenic
1055626273 9:78180218-78180240 GCCATGAATTCATAGGGAATAGG + Intergenic
1055823386 9:80295374-80295396 GCTATGAATTCATCTGGTCCTGG - Intergenic
1056671632 9:88633346-88633368 GCTATGAATTCATTAGGTCCTGG + Intergenic
1057061376 9:92006518-92006540 GCCATGAATTCATAGGGAATAGG - Intergenic
1057371393 9:94477991-94478013 GCCATGAAGCCATCAGTTCCTGG - Intergenic
1057709976 9:97431389-97431411 GACATAAAATCATAGGTTCTTGG - Intronic
1058964593 9:110024885-110024907 GCCATGAATTCATAGGGAATAGG + Intronic
1059560601 9:115331028-115331050 CCCATGAATCCTTAGATTCCAGG - Intronic
1061837549 9:133339439-133339461 GCCATGAATTCATAGGGAAGAGG - Exonic
1186785003 X:12949024-12949046 ACCAAATATTCATAGGTTCCAGG - Intergenic
1186929452 X:14372612-14372634 GCCATGAATCCATCTGGTCCTGG - Intergenic
1186983271 X:14982027-14982049 GCAGTGAAGCCATAGGTTCCTGG - Intergenic
1187146722 X:16644081-16644103 GCCACAGATTCATAGGTTTCAGG - Intronic
1187182925 X:16959701-16959723 GCCATGAAGTCATCTGGTCCTGG - Intronic
1188409466 X:29853273-29853295 GTCATGAATTCCTAGGCTCAAGG - Intronic
1189886329 X:45548063-45548085 GCCATGAGTTAAAAGCTTCCTGG - Intergenic
1191935760 X:66425707-66425729 GCCATGAATCCATCTGGTCCTGG - Intergenic
1192031320 X:67515868-67515890 GCTGTGAATTCATTTGTTCCTGG - Intergenic
1192552496 X:72065329-72065351 GCAAAGAATTCATAAGTTGCTGG + Intergenic
1193225397 X:78976579-78976601 GCCATGAATCCATGTGGTCCTGG + Intergenic
1193953744 X:87832297-87832319 GCCATGAATTCATACAGTCCTGG + Intergenic
1194040501 X:88936313-88936335 GCTATGAATTCATATGGTTCAGG + Intergenic
1194807089 X:98343645-98343667 TCAATGAATTCATCTGTTCCAGG + Intergenic
1196473439 X:116055074-116055096 GCTCTGAATTCATCTGTTCCAGG + Intergenic
1196863440 X:120048996-120049018 GCCATGAATCCATCTGGTCCTGG + Intergenic
1196879659 X:120187334-120187356 GCCATGAATCCATCTGGTCCTGG - Intergenic
1196897084 X:120347775-120347797 GCCATGAATCCATCTGGTCCTGG - Intergenic
1197805291 X:130393019-130393041 GTCATATATTCATAGGCTCCAGG - Intergenic
1198253679 X:134906608-134906630 GCCTTGAATTGATAGTTTTCTGG + Intronic
1198326686 X:135580797-135580819 GTAATGTATTCACAGGTTCCAGG + Intronic
1198612296 X:138415517-138415539 GCAATGAAGCCATAGGGTCCTGG - Intergenic
1199121879 X:144064312-144064334 GCTATGAATCCATTGGATCCTGG - Intergenic