ID: 1044678719

View in Genome Browser
Species Human (GRCh38)
Location 8:94755567-94755589
Sequence CATCTTTGAGCAAATTAATA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 255
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 237}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044678719_1044678724 2 Left 1044678719 8:94755567-94755589 CCCTATTAATTTGCTCAAAGATG 0: 1
1: 0
2: 0
3: 17
4: 237
Right 1044678724 8:94755592-94755614 GTATAGACAATGGTGGATCTGGG No data
1044678719_1044678727 12 Left 1044678719 8:94755567-94755589 CCCTATTAATTTGCTCAAAGATG 0: 1
1: 0
2: 0
3: 17
4: 237
Right 1044678727 8:94755602-94755624 TGGTGGATCTGGGCTGGGTGCGG No data
1044678719_1044678728 15 Left 1044678719 8:94755567-94755589 CCCTATTAATTTGCTCAAAGATG 0: 1
1: 0
2: 0
3: 17
4: 237
Right 1044678728 8:94755605-94755627 TGGATCTGGGCTGGGTGCGGTGG No data
1044678719_1044678726 7 Left 1044678719 8:94755567-94755589 CCCTATTAATTTGCTCAAAGATG 0: 1
1: 0
2: 0
3: 17
4: 237
Right 1044678726 8:94755597-94755619 GACAATGGTGGATCTGGGCTGGG No data
1044678719_1044678725 6 Left 1044678719 8:94755567-94755589 CCCTATTAATTTGCTCAAAGATG 0: 1
1: 0
2: 0
3: 17
4: 237
Right 1044678725 8:94755596-94755618 AGACAATGGTGGATCTGGGCTGG No data
1044678719_1044678721 -8 Left 1044678719 8:94755567-94755589 CCCTATTAATTTGCTCAAAGATG 0: 1
1: 0
2: 0
3: 17
4: 237
Right 1044678721 8:94755582-94755604 CAAAGATGCTGTATAGACAATGG No data
1044678719_1044678723 1 Left 1044678719 8:94755567-94755589 CCCTATTAATTTGCTCAAAGATG 0: 1
1: 0
2: 0
3: 17
4: 237
Right 1044678723 8:94755591-94755613 TGTATAGACAATGGTGGATCTGG No data
1044678719_1044678722 -5 Left 1044678719 8:94755567-94755589 CCCTATTAATTTGCTCAAAGATG 0: 1
1: 0
2: 0
3: 17
4: 237
Right 1044678722 8:94755585-94755607 AGATGCTGTATAGACAATGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044678719 Original CRISPR CATCTTTGAGCAAATTAATA GGG (reversed) Intronic
908430778 1:64054905-64054927 CATCTATAAGCCAATGAATACGG - Intronic
909075000 1:71042095-71042117 CATCTTTGAAGAAATTCACATGG - Intronic
910198024 1:84665991-84666013 CATCTTTCCCCAAATTGATATGG - Intronic
912010623 1:104957241-104957263 CAACTGTGAGAAAATAAATATGG - Intergenic
918606897 1:186438360-186438382 CATCTTTGAGAACAATAAAATGG + Intergenic
918655634 1:187022608-187022630 CTTCTTTGAGCAGTTTAATAAGG - Intergenic
918820272 1:189245239-189245261 CATTTTTGATAAATTTAATAGGG + Intergenic
921110036 1:212026914-212026936 CATGTTTAAACAAATCAATATGG - Intronic
922301484 1:224305295-224305317 CATCTTTGAGCAAAGAGATTGGG - Intronic
923639102 1:235734482-235734504 CCTCTTTGATCATTTTAATAAGG + Exonic
923787550 1:237082760-237082782 TTTATTTGAGCAATTTAATAGGG + Intronic
923943586 1:238857109-238857131 CTTCTTTGATCAAATCAATGAGG - Intergenic
924487309 1:244498041-244498063 CAACTTTGAGCATATTGGTAGGG - Intronic
1063099117 10:2934516-2934538 CACTTTTGAGAAAATTAATTGGG - Intergenic
1063784811 10:9369364-9369386 CATCTTTGTGTAAATCTATATGG - Intergenic
1064397706 10:14994674-14994696 CAGCTTGGAGCAAATCAATTAGG + Intergenic
1066707232 10:38193759-38193781 GTTTATTGAGCAAATTAATAGGG + Intergenic
1066785418 10:38998528-38998550 GTTTATTGAGCAAATTAATAGGG + Intergenic
1066982473 10:42430984-42431006 GTTTATTGAGCAAATTAATAGGG - Intergenic
1068122930 10:52803359-52803381 AATCTTTGAGCATAATAAAATGG - Intergenic
1068707823 10:60096329-60096351 CTTCTTTGACCTAATTAGTAAGG - Intronic
1069156773 10:65039206-65039228 CATCTTTAATGAAATTAACAAGG - Intergenic
1070155220 10:73829609-73829631 CATATTTGAGCATATTTAAAAGG - Intronic
1070635460 10:78123094-78123116 CATCAGTGATCAAATTAGTAAGG + Intergenic
1071427274 10:85571564-85571586 CATTTTTAACCAAATTAACAAGG - Intergenic
1071777013 10:88800310-88800332 CATATTACAGCAAAGTAATATGG + Intergenic
1074185197 10:111095036-111095058 AATCTTTGAGCATATTGATGAGG - Intergenic
1078125989 11:8563891-8563913 CAGATTTGAGGAAATTAAAAGGG + Intronic
1079498425 11:21073233-21073255 CATCTTTGAGTAGATTACTTGGG + Intronic
1080030105 11:27651219-27651241 CAACATGCAGCAAATTAATAAGG - Intergenic
1081878364 11:46426787-46426809 CAGCTTTAAGAAAATTAATGAGG + Intronic
1084807037 11:71586211-71586233 CAGCTTGGAGCAAATCAATTAGG - Intronic
1084846982 11:71908682-71908704 CAGCTTGGAGCAAATCAATTAGG - Intronic
1085859894 11:80220745-80220767 CAGCTTTGTGGAAAATAATATGG + Intergenic
1086168135 11:83803515-83803537 CTTGTTTGAACAAAATAATAAGG - Intronic
1086386574 11:86315035-86315057 AATCTTTGGGAAAATTAAGATGG + Intronic
1086857432 11:91881956-91881978 CTTCTTTCATCAATTTAATAGGG + Intergenic
1086991789 11:93311659-93311681 CAGTTTTGAACAACTTAATAGGG + Intergenic
1088074042 11:105825047-105825069 CATCTTTGAGACCATAAATAGGG - Intronic
1088278862 11:108117009-108117031 CATGTTTGTGTATATTAATATGG - Intergenic
1088571328 11:111226803-111226825 AATCTGTGAGCAAAGTAAGATGG + Intergenic
1092432877 12:8422901-8422923 CAGCTTGGAGCAAATCAATTAGG + Intergenic
1092470477 12:8774031-8774053 CATTTTTTAGCAATTTAAAAGGG - Exonic
1093668563 12:21844649-21844671 AGTCCTTGAGCAAATGAATAGGG - Intronic
1094143085 12:27200619-27200641 CATATATGAGCAAATTAAATAGG + Intergenic
1094877324 12:34665009-34665031 CATTTTTGAGCTACCTAATATGG - Intergenic
1095994063 12:48063712-48063734 CATCATTGAGCCAATTCAGATGG + Exonic
1097331975 12:58340981-58341003 CATCTTTGAGAAGCTTAATGGGG + Intergenic
1098157609 12:67615788-67615810 CAGGTTTGAGCAAATTGATCCGG + Intergenic
1098524181 12:71467907-71467929 CAACTTTGTGAGAATTAATAAGG - Intronic
1098632242 12:72738193-72738215 CATTTTTAAGCATATTAATGAGG - Intergenic
1098877998 12:75887026-75887048 CATCTTTAAGTAATATAATATGG + Intergenic
1099829801 12:87826892-87826914 CATCTTTGGGCAAGTTACTTGGG - Intergenic
1101495716 12:105252250-105252272 CAGTTTTTAGCAAATTCATATGG - Intronic
1101647379 12:106643963-106643985 CATATGTGTGCAAATTCATAGGG - Intronic
1102609675 12:114100533-114100555 CATCTTAGCCCAAATTAATCCGG - Intergenic
1104608549 12:130207644-130207666 CATTTTTGGACAAATTTATATGG + Intergenic
1106469296 13:30040275-30040297 CATATTTGAGGAAATAAAGAGGG + Intergenic
1106749558 13:32747167-32747189 CATCATTGAGAAAAGTAAAAGGG + Intronic
1107365549 13:39669577-39669599 AATTTTTGAGTAAATGAATATGG + Intronic
1108189798 13:47926129-47926151 TGTTTTTGAGGAAATTAATAAGG - Intergenic
1109772340 13:66993522-66993544 CATCTTTGTGCAAGTTGGTAGGG - Intronic
1110262774 13:73504276-73504298 AATGTCAGAGCAAATTAATATGG + Intergenic
1111187509 13:84758254-84758276 CAAAATTGAGCAAAATAATATGG - Intergenic
1114435220 14:22700571-22700593 CATCTTTGAACAAAATGATGAGG + Intergenic
1115397971 14:32931628-32931650 CATCTTTACGAGAATTAATATGG - Intergenic
1116610958 14:47071178-47071200 CATCTTTGAGCAACATACTGGGG - Intronic
1117717974 14:58600130-58600152 AATCTTTGAGCACAATAAGATGG + Intergenic
1118020325 14:61706106-61706128 CATCTAAGAGCATATAAATAAGG + Intronic
1122313642 14:100813004-100813026 ACTCTTTGAGCAAATGAAAAGGG + Intergenic
1125134553 15:36326777-36326799 CATCTTACAGCAAAATAACATGG - Intergenic
1125461850 15:39914915-39914937 AGTCTTTGAGCAAAATCATATGG - Intronic
1125607299 15:40947801-40947823 CATCTTTGAGCAGACATATAGGG + Intergenic
1126586031 15:50288356-50288378 AATCTTTGAGAAAATGACTAGGG - Intronic
1126942610 15:53782542-53782564 AATATTTGAACAAATTAAAATGG + Intergenic
1128717982 15:69922903-69922925 CATCTTAGATCAAAGTGATAAGG - Intergenic
1129120182 15:73391650-73391672 CATCTCTGAGCCAATTACCATGG + Intergenic
1129603083 15:77011665-77011687 CATGTATAAGCAAATAAATATGG - Intronic
1131039190 15:89246340-89246362 CATCTTTGTGCAGATTAAAGTGG - Intronic
1138242018 16:55435006-55435028 TAACTCTGAGCAAATAAATATGG + Intronic
1144262626 17:13537464-13537486 CACCTTTGTGCAAAGTAATGGGG - Intronic
1144320611 17:14115447-14115469 CATCTTTGTGGAAAATAATATGG + Intronic
1147763677 17:42818381-42818403 GATCTTAGAGCAAATGAATGAGG - Exonic
1148541523 17:48484268-48484290 CATCATACAGCAAGTTAATATGG + Intergenic
1153416879 18:4855489-4855511 CGTCTTTGAGCAGAATAATGGGG + Intergenic
1155059355 18:22215099-22215121 CATCTTTGAGTGAGTTAATCTGG + Intergenic
1156279597 18:35623080-35623102 CATCTTTTAAGAAATTAAGAGGG + Intronic
1156603731 18:38640923-38640945 CATCTCTGTGCAAAATAAAAAGG - Intergenic
1156635718 18:39026939-39026961 CATGTGTGAACAAATTATTAAGG - Intergenic
1156795270 18:41037300-41037322 CATCTTTTAGGGAATAAATATGG - Intergenic
1156808191 18:41212890-41212912 CATCTTTGAGCAATTACACAAGG - Intergenic
1158066527 18:53416719-53416741 CAGCTTTTAGTAAATAAATAAGG - Intronic
1158321367 18:56267864-56267886 CATCTTTGAGGAGATTAGGACGG - Intergenic
1161266056 19:3365386-3365408 CATCTTTAAGCCACTTTATAGGG + Intronic
1164407458 19:27964632-27964654 GTTTATTGAGCAAATTAATAGGG + Intergenic
1164966083 19:32485529-32485551 CATCTTAGACAAAATCAATATGG - Exonic
1167071494 19:47224662-47224684 CATCAATGAGAAAATGAATAAGG + Intronic
925211670 2:2053579-2053601 TATATTTGAGGAAATTAAGAAGG - Intronic
925750051 2:7080639-7080661 CATTTTTGATGAAATTAAAATGG - Intergenic
925797217 2:7558906-7558928 CATATTTGAGCATATTAAGATGG - Intergenic
926308298 2:11656408-11656430 CATGTTTGAGAAAAGTAACATGG + Intergenic
927918731 2:26954628-26954650 CTTCTTTAAGCAACTAAATATGG + Intergenic
928544770 2:32319470-32319492 CATCAGTGAGAAAATTAAGAGGG + Intergenic
928816960 2:35308449-35308471 TGTCTTTGAGCATATGAATACGG - Intergenic
928829666 2:35465223-35465245 CAATTTTGAGCAAAATAATACGG - Intergenic
929422466 2:41807084-41807106 CATCTTTTGATAAATTAATATGG - Intergenic
930289560 2:49476679-49476701 CATTTTGGAGAAAATTAAAAAGG - Intergenic
930966218 2:57331069-57331091 CATCTTTGAGGAATGTATTAAGG + Intergenic
931518043 2:63063233-63063255 CATCTTAGAGCAAATGAGAATGG - Intergenic
936587719 2:113773052-113773074 CTTCTTTGATAAAATTAATTAGG + Intergenic
936769891 2:115899359-115899381 CATTTTTGAGCAAATAAAGTTGG + Intergenic
937057372 2:118950798-118950820 CATCTTTGAGGAAAAAAAAAGGG - Intronic
938920047 2:135986529-135986551 AATCTTTGATCAATTAAATAGGG - Intergenic
939088135 2:137746238-137746260 AATCTTTGAGCAATGTGATAAGG - Intergenic
939628977 2:144512476-144512498 TTTCTTTAAGCAAATTAAGAAGG + Intronic
941498068 2:166231878-166231900 CTTCTCTGAGCAATTTAACACGG - Intronic
942841054 2:180360857-180360879 CATCTTGGAGAAAAATAAAATGG + Intergenic
943286116 2:186003004-186003026 CTTCTTTTAGCATATTAATTGGG + Intergenic
943746332 2:191466005-191466027 CATCTTTAAACAAAAGAATACGG + Intergenic
943801612 2:192066937-192066959 CATCTTTCAGGAATTAAATAAGG - Intronic
944004253 2:194883479-194883501 CATCTTAGAACAAAGTAATAGGG + Intergenic
944197899 2:197074473-197074495 CATCTCTTAGAAAAATAATATGG - Intronic
945629719 2:212258896-212258918 CATCTTAGAGGAAAGTAATAAGG + Intronic
945854828 2:215056792-215056814 CCTCTTTAAGTAATTTAATAGGG - Intronic
945910174 2:215639943-215639965 CATCTCTGAGCAAAGGAGTAGGG + Intergenic
946049644 2:216851605-216851627 CAGCTTTGAGCCCATTCATAAGG + Intergenic
946308318 2:218868609-218868631 CATGTTTGAGGAAATGAATTAGG + Intronic
1170015156 20:11772263-11772285 AATCTTTGAGCAAAATAAAATGG - Intergenic
1170221911 20:13950427-13950449 CAACTTTCAGCCAAGTAATAAGG + Intronic
1170291433 20:14773831-14773853 AATCTGTGTGCACATTAATATGG - Intronic
1170541637 20:17394755-17394777 CATATTGTAGCAACTTAATAAGG + Intronic
1174737201 20:52975699-52975721 AATATGTGAGCAAATAAATAAGG - Intronic
1178010436 21:28279286-28279308 CAGCTTTGAGAAATTTAGTAGGG + Intergenic
1178446287 21:32646635-32646657 AATCTCTGAGCAAGTTAAAATGG - Intronic
1184298851 22:43543252-43543274 CATCTTTGAACAAATTCTGAAGG + Intronic
951712605 3:25600342-25600364 CATATTTGATCAAATGAATCAGG + Intronic
952103648 3:30044091-30044113 CATGTTTGAGCGATTTAATGGGG + Intergenic
952194599 3:31061219-31061241 AATCTTTTAAAAAATTAATAAGG - Intergenic
952333717 3:32387129-32387151 CATCTTTCAACGAATTACTATGG - Intergenic
953309834 3:41865669-41865691 CTTCTTTGAGCCAAGTAATTGGG - Intronic
955288097 3:57663976-57663998 CATCTTTGGGCAAGTTAGGAGGG - Intronic
956602438 3:71036410-71036432 CATCTTTGACCAAATGCTTAAGG + Intronic
956891333 3:73617088-73617110 CAGCTTTTAGCAAAATACTAGGG + Intronic
957465919 3:80590479-80590501 AATATTTTAGAAAATTAATATGG + Intergenic
957624744 3:82643081-82643103 CACCTTTGTGCAAAGGAATATGG - Intergenic
957729384 3:84113085-84113107 CATATTTGAGCAAATTGTTCTGG - Intergenic
958675187 3:97260610-97260632 CATCTGGGAGCAAATTTATATGG + Intronic
960211693 3:114975768-114975790 CACCTTTGAGAAAATTAATTTGG + Intronic
960415446 3:117379945-117379967 CAACTGTGAGCAATTTTATATGG + Intergenic
961274634 3:125717277-125717299 CAGCTTGGAGCAAATCAATTAGG - Intergenic
961699422 3:128730770-128730792 CATCTTCAAGCAAATGAACAAGG - Intronic
964931867 3:162034680-162034702 CATCTTTGTGCAGAATAATCAGG + Intergenic
965378730 3:167960727-167960749 CTTCTCTGAGCAAAGTAAAATGG + Intergenic
965427274 3:168542740-168542762 CATCTTTGGGTAAATGAACAGGG + Intergenic
966508424 3:180733355-180733377 CATTTATGAGAAAATTAGTAAGG + Intronic
967026184 3:185566363-185566385 GCTCTTTGAGCAGATTGATATGG + Intergenic
967472558 3:189879306-189879328 CAACTTTCAGCAAAATAAAAGGG + Intronic
969635435 4:8366465-8366487 GATCTATGTGCAAATTAATAAGG + Exonic
969788592 4:9476504-9476526 CAGCTTGGAGCAAATCAATTAGG - Intergenic
969914537 4:10477044-10477066 CAACTTTGTGAAAATTAATCTGG - Intergenic
970272812 4:14365461-14365483 CATCTATGAGCAAATCAATGTGG + Intergenic
970963453 4:21899911-21899933 CATTCTTCACCAAATTAATATGG + Intronic
971364291 4:25965140-25965162 CATCTTTGAAGAAATGAATAAGG - Intergenic
972109069 4:35532380-35532402 CATATTTGAGGAAATCAATTTGG - Intergenic
972384116 4:38547030-38547052 CATCATTCAGCAAATTCATTTGG - Intergenic
972543435 4:40057998-40058020 CATCTTTGAGCCAATCAGCAAGG + Intronic
974093629 4:57338469-57338491 CAAATTTGAGAAAATGAATAAGG - Intergenic
974183978 4:58422064-58422086 CAATTGTGAGCTAATTAATATGG - Intergenic
974225671 4:59039628-59039650 CATCTGTGAACACATTAATAAGG + Intergenic
974585191 4:63864899-63864921 CATATGTGAGCAAATTATTTGGG - Intergenic
974704157 4:65489679-65489701 CACTTTTAAGCAAATTAACATGG - Intronic
975224894 4:71859900-71859922 AATCTTTGATAAAATTAATTTGG - Intergenic
975244348 4:72102323-72102345 AATCTTTCAATAAATTAATATGG + Intronic
975714471 4:77192477-77192499 TATCTTTGATCATATTAATCTGG + Intronic
975802277 4:78073398-78073420 ATAGTTTGAGCAAATTAATATGG - Intronic
981017066 4:139984991-139985013 CAGCTTTCTGCAATTTAATATGG + Intronic
983725399 4:170917084-170917106 CATCTTTGAACAATAGAATATGG - Intergenic
985006451 4:185539357-185539379 CATCTGTGAGCATAATAAAATGG + Intergenic
985339084 4:188929415-188929437 TATCTTAGAGAAAATTACTAGGG + Intergenic
987635719 5:20538281-20538303 CAGCTTTGATCAATTTAATTAGG - Intronic
987973934 5:24987654-24987676 CATATTTTAACAAATTATTATGG - Intergenic
988653075 5:33175094-33175116 TTTCTTTGAGAAAATCAATATGG + Intergenic
990567642 5:57045565-57045587 CATTTTTGAGCATATTACAAGGG + Intergenic
990687143 5:58317351-58317373 GATCTTCCAGCAAATAAATATGG - Intergenic
991120047 5:63002162-63002184 CATTTTTGAGCAAATAAATTTGG - Intergenic
991211670 5:64112421-64112443 ATTCTTTGAAAAAATTAATAAGG + Intergenic
991468764 5:66944917-66944939 CATCTTTGACTAAATCAAAAAGG - Intronic
992123989 5:73623086-73623108 GAGCTTTGAGATAATTAATAGGG - Intergenic
992544892 5:77803946-77803968 CTTATTTGTGCAAATTTATAAGG + Intronic
992887246 5:81170740-81170762 TATCTATAAGCAAATAAATAAGG - Intronic
995976858 5:118047004-118047026 CATCATTGAGCCAACAAATAGGG + Intergenic
996585718 5:125086039-125086061 TATATTTTAGCAATTTAATATGG + Intergenic
999514272 5:152285333-152285355 TATCTTTGAACAAATCACTATGG + Intergenic
999683784 5:154084312-154084334 CCTCTGTGATCAAATTAATGAGG - Intronic
1003354007 6:5348117-5348139 CATCTTTGGGAAAATGAACAGGG - Intronic
1004385353 6:15167981-15168003 CATCTTTGAAGAAATAAATGTGG - Intergenic
1005451352 6:25975967-25975989 CAACTTTGAGTCAAGTAATATGG - Intronic
1007982808 6:46176378-46176400 TAGCTTTGAGCAAATTATGAGGG - Intergenic
1011353641 6:86451113-86451135 CATTTGTGAGCAAAATAATGAGG + Intergenic
1012849886 6:104433905-104433927 CATCTTGAGGCAAATTTATATGG + Intergenic
1013381054 6:109571116-109571138 CATCTTTGAGCAACTTTTTAAGG - Intronic
1014843864 6:126252081-126252103 AATCTGTGAGCATATTAAAATGG - Intergenic
1015152988 6:130059460-130059482 CATGTATGTGCAAATCAATAGGG - Intronic
1019862037 7:3668172-3668194 CATCTTAGAACAAAATAATCAGG + Intronic
1020311988 7:6875060-6875082 CAGCTTGGAGCAAATCAATTAGG + Intergenic
1020508910 7:9027801-9027823 CATCTTTAAGAAAATTTATAAGG + Intergenic
1022106000 7:27198811-27198833 CATTTTTGAGAGAATGAATAGGG + Intronic
1022864374 7:34401739-34401761 TATCTTTGTGCACATTATTAAGG + Intergenic
1023305397 7:38820520-38820542 AAGCTTTAAGAAAATTAATATGG - Intronic
1023342772 7:39239539-39239561 AATATTTTAGAAAATTAATATGG - Intronic
1024189500 7:46991738-46991760 TACTTTTGAGCAAATTAATTTGG - Intergenic
1024818370 7:53297350-53297372 CATTTTTCAAGAAATTAATAAGG + Intergenic
1028956345 7:96697502-96697524 CATTTTTGAGAAAAGTAAAAAGG + Intronic
1029056102 7:97744402-97744424 CTTCTTTGAAAAAATTACTAAGG + Intergenic
1030231914 7:107216689-107216711 CATCTTGGAACAAATGAAAATGG + Intronic
1031224205 7:119013950-119013972 CACATTTGAGTAAATGAATATGG - Intergenic
1031631122 7:124044203-124044225 AACCTTTGAAAAAATTAATAAGG + Intergenic
1033303317 7:140205678-140205700 CATCTGTGAACCAATTAATTAGG - Intergenic
1035632485 8:1119144-1119166 CATCTCAGTGCAAAATAATATGG - Intergenic
1036903978 8:12692222-12692244 CAGCTTGGAGCAAATCAATTAGG + Intergenic
1036906447 8:12711892-12711914 CAGCTTGGAGCAAATCAATTAGG + Intergenic
1037058191 8:14471544-14471566 CTTATTTGAGGAAATTCATATGG - Intronic
1041013384 8:53566889-53566911 CTTCTTTGAGATAATTAATGTGG - Intergenic
1041442906 8:57917491-57917513 CATCTTTGACCATGTGAATAAGG + Intergenic
1041659738 8:60390181-60390203 TATTTATGAGAAAATTAATAGGG - Intergenic
1041961367 8:63620615-63620637 CATCTTTAATCACATTAATTCGG - Intergenic
1042783872 8:72524524-72524546 AATCTGTGAGCAACTTCATATGG + Intergenic
1044133173 8:88551750-88551772 CATCTTTGATCCAATCACTATGG - Intergenic
1044678719 8:94755567-94755589 CATCTTTGAGCAAATTAATAGGG - Intronic
1045497334 8:102719614-102719636 CATTTTTGAATAAATGAATAAGG + Intergenic
1050289320 9:4137608-4137630 CATCTCTGAGCCACTTCATAAGG + Intronic
1050884322 9:10744578-10744600 CATCTTTTAGGAAAGTACTATGG + Intergenic
1051817429 9:21125374-21125396 CATGTTTATGCAAATTAATTTGG - Intergenic
1051992339 9:23166746-23166768 AATCATTGAATAAATTAATAAGG + Intergenic
1052365211 9:27604787-27604809 TAGCCTCGAGCAAATTAATAAGG - Intergenic
1052511239 9:29423701-29423723 CATGTTTGTGCATATGAATATGG + Intergenic
1053861230 9:42388159-42388181 CATTTTTGAGGAAAGAAATAAGG + Intergenic
1055272691 9:74579406-74579428 CATCTTTGAGCATTTTAAACAGG + Intronic
1056672392 9:88641699-88641721 CAGATATGAGCAAATAAATATGG - Intergenic
1058772796 9:108253969-108253991 CATCTTTGACGTAATAAATATGG + Intergenic
1059581294 9:115551247-115551269 CATCACTGAGCTAAATAATAAGG - Intergenic
1186330937 X:8533328-8533350 CTTCTTTGAGCAAATAAAAAAGG - Intronic
1186951471 X:14630241-14630263 CATCTTTAAGCTACTTATTAGGG - Intronic
1189798242 X:44666734-44666756 GATCTTTGAGAAAAGTGATAAGG - Intergenic
1190147444 X:47908089-47908111 CATCATTAAGAAAGTTAATAGGG + Intronic
1190712411 X:53080218-53080240 CAGCTTTGACCAAATTTAGAGGG + Exonic
1192589472 X:72347753-72347775 CAGCTTTAAGCAAATGAACATGG + Intronic
1192715758 X:73640770-73640792 CTTCTTTGAAAAAATTAGTAAGG - Intronic
1192863113 X:75100092-75100114 CAACTTAGAGCATATTTATAAGG - Intronic
1193292115 X:79787152-79787174 CATCTTTTAAAAAAATAATAGGG + Intergenic
1193909721 X:87288428-87288450 AATCTTTTAGCAAATGTATAAGG + Intergenic
1195546724 X:106120471-106120493 AATCTTTGGGAAAATTAATTTGG - Intergenic
1199476157 X:148247646-148247668 TATATTTGAGGAAATTACTAGGG + Intergenic
1201432307 Y:13915469-13915491 CTTGTTTGAGCAAATAAAAAAGG + Intergenic
1201673786 Y:16556416-16556438 TATCTGTGAGCAAATAAATGTGG + Intergenic