ID: 1044678720

View in Genome Browser
Species Human (GRCh38)
Location 8:94755568-94755590
Sequence GCATCTTTGAGCAAATTAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 4, 3: 17, 4: 204}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044678720_1044678728 14 Left 1044678720 8:94755568-94755590 CCTATTAATTTGCTCAAAGATGC 0: 1
1: 0
2: 4
3: 17
4: 204
Right 1044678728 8:94755605-94755627 TGGATCTGGGCTGGGTGCGGTGG No data
1044678720_1044678727 11 Left 1044678720 8:94755568-94755590 CCTATTAATTTGCTCAAAGATGC 0: 1
1: 0
2: 4
3: 17
4: 204
Right 1044678727 8:94755602-94755624 TGGTGGATCTGGGCTGGGTGCGG No data
1044678720_1044678725 5 Left 1044678720 8:94755568-94755590 CCTATTAATTTGCTCAAAGATGC 0: 1
1: 0
2: 4
3: 17
4: 204
Right 1044678725 8:94755596-94755618 AGACAATGGTGGATCTGGGCTGG No data
1044678720_1044678724 1 Left 1044678720 8:94755568-94755590 CCTATTAATTTGCTCAAAGATGC 0: 1
1: 0
2: 4
3: 17
4: 204
Right 1044678724 8:94755592-94755614 GTATAGACAATGGTGGATCTGGG No data
1044678720_1044678721 -9 Left 1044678720 8:94755568-94755590 CCTATTAATTTGCTCAAAGATGC 0: 1
1: 0
2: 4
3: 17
4: 204
Right 1044678721 8:94755582-94755604 CAAAGATGCTGTATAGACAATGG No data
1044678720_1044678722 -6 Left 1044678720 8:94755568-94755590 CCTATTAATTTGCTCAAAGATGC 0: 1
1: 0
2: 4
3: 17
4: 204
Right 1044678722 8:94755585-94755607 AGATGCTGTATAGACAATGGTGG No data
1044678720_1044678723 0 Left 1044678720 8:94755568-94755590 CCTATTAATTTGCTCAAAGATGC 0: 1
1: 0
2: 4
3: 17
4: 204
Right 1044678723 8:94755591-94755613 TGTATAGACAATGGTGGATCTGG No data
1044678720_1044678726 6 Left 1044678720 8:94755568-94755590 CCTATTAATTTGCTCAAAGATGC 0: 1
1: 0
2: 4
3: 17
4: 204
Right 1044678726 8:94755597-94755619 GACAATGGTGGATCTGGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044678720 Original CRISPR GCATCTTTGAGCAAATTAAT AGG (reversed) Intronic
901617219 1:10551138-10551160 GCATCTTGCAGCAAATACATGGG + Intronic
901850687 1:12012933-12012955 TCATCTTTGAGGAAATGAGTTGG + Exonic
905704981 1:40048853-40048875 GCATTTTGAAGCAAATCAATTGG + Intronic
906114288 1:43346091-43346113 GTAACTTTGGGCAAATTACTTGG - Intronic
906115400 1:43353261-43353283 GCCTCTTTGAGTATATTAGTAGG + Intergenic
907269837 1:53284397-53284419 GCATCTTTGGGCTAGTTACTTGG - Intronic
907644957 1:56233046-56233068 GGGACCTTGAGCAAATTAATTGG - Intergenic
908955065 1:69615004-69615026 CCATCTTTGAGCCAAATATTTGG + Intronic
909558186 1:76979485-76979507 GCATCTTTGTGAAAATCAATTGG - Intronic
910015082 1:82512804-82512826 GAATCTTTCAGTAAAATAATGGG + Intergenic
910263912 1:85318063-85318085 GCATCTTTTAGCAAATTTGAAGG - Intergenic
910774106 1:90857809-90857831 CCCTCTTTGAGCAAATAAAATGG - Intergenic
911886522 1:103307686-103307708 GCATCTTTGGGCAGAGTAAATGG - Intergenic
912055123 1:105586935-105586957 GCAACATTTAGCAAATGAATAGG - Intergenic
912139257 1:106701707-106701729 GCATCTTTTAGTAAATTACTGGG + Intergenic
916471911 1:165132027-165132049 GGATCTGTGAGCAAATTACATGG + Intergenic
917578846 1:176352827-176352849 GTATCTTTTTGAAAATTAATTGG + Intergenic
918178051 1:182062152-182062174 GCATCTTTGAGCCAATGAATGGG - Intergenic
918820271 1:189245238-189245260 GCATTTTTGATAAATTTAATAGG + Intergenic
919017058 1:192052099-192052121 TTATCTTAGAGCAAATTACTTGG - Intergenic
922301485 1:224305296-224305318 GCATCTTTGAGCAAAGAGATTGG - Intronic
924551266 1:245080197-245080219 GGATCTTTGAGCCTTTTAATAGG + Intronic
1062777007 10:159502-159524 GCATCTTTTAATAAATTTATAGG + Intronic
1063099118 10:2934517-2934539 CCACTTTTGAGAAAATTAATTGG - Intergenic
1064406118 10:15065165-15065187 CCAACTTTGAGCAAAGTAACTGG + Intronic
1065547813 10:26839557-26839579 GCATCTTTTAACAAACTACTAGG + Intronic
1066707231 10:38193758-38193780 GGTTTATTGAGCAAATTAATAGG + Intergenic
1066785417 10:38998527-38998549 GGTTTATTGAGCAAATTAATAGG + Intergenic
1066982474 10:42430985-42431007 GGTTTATTGAGCAAATTAATAGG - Intergenic
1068282167 10:54887653-54887675 GCATTTTTTTGAAAATTAATAGG + Intronic
1068668358 10:59699225-59699247 GTTAATTTGAGCAAATTAATAGG - Intronic
1069779405 10:70945386-70945408 GGGTCCTTGAGCAAATTAAATGG - Intergenic
1073619709 10:105034360-105034382 GCATGTTTGAGAAACTAAATGGG + Intronic
1078125988 11:8563890-8563912 GCAGATTTGAGGAAATTAAAAGG + Intronic
1078458110 11:11491480-11491502 GCTCCTTTGAGCAAATCAATCGG - Intronic
1079498424 11:21073232-21073254 TCATCTTTGAGTAGATTACTTGG + Intronic
1081197401 11:40178244-40178266 ACATATTTGAGCAAATAGATAGG + Intronic
1081696791 11:45117420-45117442 GCATCTTTAAATAAATTATTTGG - Intronic
1082687115 11:56253391-56253413 AGATCTCTGAACAAATTAATTGG - Intergenic
1083803531 11:65060068-65060090 GCATCTTTGAGCCCATCCATGGG - Intergenic
1085543918 11:77299248-77299270 CCATCTTTGGGCAAATTAATGGG - Intronic
1085873432 11:80378146-80378168 AAATCTTTCAGAAAATTAATAGG - Intergenic
1086949575 11:92877656-92877678 GAAGCTCTGAGCACATTAATGGG - Intronic
1087826231 11:102767869-102767891 ATATCTTTGAGAAAATCAATGGG + Intergenic
1093730704 12:22562653-22562675 GCAGCTGTGGGCAAATTTATAGG - Intergenic
1097331974 12:58340980-58341002 ACATCTTTGAGAAGCTTAATGGG + Intergenic
1097612929 12:61848182-61848204 GCATGTATGGGCAAATAAATCGG + Intronic
1098377419 12:69832012-69832034 TGTTCTTTGAGGAAATTAATTGG + Intronic
1099629536 12:85124594-85124616 GAATCCTTCAGCAAATTACTAGG - Intronic
1099829802 12:87826893-87826915 GCATCTTTGGGCAAGTTACTTGG - Intergenic
1106749557 13:32747166-32747188 GCATCATTGAGAAAAGTAAAAGG + Intronic
1108250927 13:48567127-48567149 GCATCTTGGAGAAACTGAATAGG - Intergenic
1108480842 13:50869420-50869442 CCATCATTGAGAAAATAAATAGG + Intergenic
1110044366 13:70810233-70810255 CCATCTTTGAGTAAATTGTTGGG + Intergenic
1110267295 13:73552805-73552827 GCATCTTTGAGCTATTTTCTGGG - Intergenic
1111169746 13:84510216-84510238 GCATCTTTGAGATAATTATGTGG - Intergenic
1112023355 13:95391071-95391093 GTATCCTGGAGCAAATAAATTGG - Intergenic
1112267651 13:97940105-97940127 GCATCTTTGAGCAAAGTCTGTGG + Intergenic
1116610959 14:47071179-47071201 CCATCTTTGAGCAACATACTGGG - Intronic
1117720565 14:58625002-58625024 ACATCTTTGAGCAAGAGAATTGG + Intergenic
1117787356 14:59300275-59300297 GCAACTTTGAGCAAATTTTGTGG - Intronic
1117845889 14:59911609-59911631 GCATCTCTGAGCAAAGAAAAGGG - Intergenic
1120651852 14:87143692-87143714 GCATCTATTAGCAAATTCACAGG + Intergenic
1124484489 15:30102988-30103010 GCAACTGTGTGCAAATAAATAGG - Intergenic
1124519094 15:30394236-30394258 GCAACTGTGTGCAAATAAATAGG + Intergenic
1124539562 15:30571985-30572007 GCAACTATGTGCAAATAAATAGG - Intergenic
1124759089 15:32435587-32435609 GCAACTATGTGCAAATAAATAGG + Intergenic
1126745390 15:51821140-51821162 GCAACTATGTGCAAATAAATTGG + Intergenic
1126793222 15:52239407-52239429 GCATCTTTGAGCAAATTAGGAGG + Intronic
1126996834 15:54453607-54453629 ACATCTTTGTGCAAATTATCAGG + Intronic
1127703625 15:61526197-61526219 GCATCTGTGAGCACATGACTGGG - Intergenic
1131683120 15:94744744-94744766 GAATCATTAAGCACATTAATAGG - Intergenic
1131688843 15:94804496-94804518 GGATCATTTAGCAAATTAAAAGG + Intergenic
1132138852 15:99372310-99372332 GAATCTTTGAGCATATTTACAGG - Intronic
1134288121 16:12879994-12880016 CCATCTTTGAGCCAATCAGTAGG - Intergenic
1136595892 16:31249675-31249697 GTATCTGTGTGCTAATTAATGGG - Intergenic
1138182013 16:54947497-54947519 GCAGCTTTTAGCAAAGGAATTGG - Intergenic
1138938493 16:61760192-61760214 ACATTTTTGAACAAATTAATTGG + Intronic
1144262627 17:13537465-13537487 TCACCTTTGTGCAAAGTAATGGG - Intronic
1145227711 17:21144374-21144396 GCATGTTGGAGCAACTTATTTGG - Intronic
1147397782 17:40158268-40158290 GCCTCTTTGACCAGATTATTGGG + Intronic
1147933330 17:43996419-43996441 GCATCCATGAGCAAATAAAATGG + Intronic
1148432313 17:47651362-47651384 ACATCTTTGAGAAAGGTAATAGG + Intronic
1149524301 17:57341998-57342020 GCATGTTAGAGCAGAGTAATTGG + Intronic
1152450526 17:80376307-80376329 GAAGCTGTGAGCAAATTCATTGG + Exonic
1153416878 18:4855488-4855510 GCGTCTTTGAGCAGAATAATGGG + Intergenic
1155670292 18:28362744-28362766 GCATTCTTGAGGAAATTACTTGG + Intergenic
1159042754 18:63340552-63340574 GCTTTTTTGAGCAAATGAATAGG - Intronic
1159419168 18:68193997-68194019 GCATCTTTGAGAAAAAGAAAGGG + Intergenic
1159726040 18:71960901-71960923 GCCTCTTTGAGCAAATAATGAGG + Intergenic
1160058434 18:75508176-75508198 GCATCTTTAAACAGATTTATTGG - Intergenic
1160299293 18:77665696-77665718 GCATCTCAGAGCAAATGAAGTGG + Intergenic
1161266055 19:3365385-3365407 GCATCTTTAAGCCACTTTATAGG + Intronic
1164407457 19:27964631-27964653 GGTTTATTGAGCAAATTAATAGG + Intergenic
1164512344 19:28907854-28907876 GCCTCCTTGATGAAATTAATTGG + Intergenic
1168520390 19:57045670-57045692 GCAACTTTTAAAAAATTAATAGG + Intergenic
925255849 2:2486781-2486803 ACATCTTTGAACATATTTATTGG + Intergenic
925597420 2:5569555-5569577 GCTTCTTTCAGAAAAATAATTGG + Intergenic
926333103 2:11841554-11841576 GCATCTTTGGCTAAATAAATAGG - Intergenic
928193733 2:29197410-29197432 GCATCTTGGGGCATATTAAAGGG + Intronic
930557716 2:52920473-52920495 GCATGTTTGACAAATTTAATCGG - Intergenic
931135080 2:59389996-59390018 GCAGCTATGAACAAGTTAATTGG - Intergenic
931973267 2:67614231-67614253 GTATTGTTGAGAAAATTAATTGG + Intergenic
932568226 2:72922888-72922910 CCATCTCTGAAGAAATTAATTGG + Intronic
933333444 2:80924068-80924090 GCATCTTTTCACAAGTTAATTGG + Intergenic
933370958 2:81414876-81414898 GCATCTCTGAGCATGTTACTTGG - Intergenic
934878982 2:97956451-97956473 GAAACTTTGATCAAAGTAATAGG - Intronic
935924899 2:108057032-108057054 GCATTTTAGATCAAATTAACTGG - Intergenic
937014433 2:118591312-118591334 GCATCTTTGAGCAAATCCAAGGG - Intergenic
937226201 2:120371109-120371131 GCATCTTTGCAAAAAGTAATAGG - Intergenic
939760414 2:146169966-146169988 GAATGTTTGAGAAAATTATTTGG + Intergenic
939948060 2:148434299-148434321 GTTTCTTTGAAAAAATTAATAGG - Intronic
941752882 2:169151888-169151910 GCATCTTTGAAGAAGCTAATTGG - Intronic
942637136 2:178019929-178019951 GCATCTTTGACCAAAATCAGTGG + Intronic
943053464 2:182945637-182945659 GCATGTTTGAGCATTTTGATAGG - Intronic
943286115 2:186003003-186003025 TCTTCTTTTAGCATATTAATTGG + Intergenic
944004252 2:194883478-194883500 GCATCTTAGAACAAAGTAATAGG + Intergenic
944932222 2:204531344-204531366 GGACCTTTGAACAAAATAATTGG - Intergenic
946186084 2:217981156-217981178 GCATCTTTGTGCAAACTAGAAGG + Intronic
946625445 2:221607661-221607683 GCAACCTTGGGCAAATTACTTGG - Intergenic
946720684 2:222603902-222603924 ACATCTTTGACCATATTAAGTGG - Intronic
948707585 2:239804689-239804711 GCATCTTTGAGCCCAGTATTTGG + Intergenic
949081709 2:242105892-242105914 TCATCATTAAGAAAATTAATAGG + Intergenic
1168946122 20:1759561-1759583 TCATTTTTGAGCAAATTAAATGG - Intergenic
1177668265 21:24190300-24190322 GCATCTTCAAGAAAATTCATAGG + Intergenic
1184313844 22:43666967-43666989 GCATCTTTCAACAATTTAAAAGG - Intronic
1184824143 22:46935713-46935735 GCATCTTTGAGGAAGAGAATGGG - Intronic
949210231 3:1490282-1490304 GCCTATTAGAACAAATTAATTGG + Intergenic
951903777 3:27683050-27683072 GCATGTCTGAGTGAATTAATTGG - Intergenic
952053446 3:29414455-29414477 GCATTTCTGAGCAACTTATTTGG - Intronic
952103647 3:30044090-30044112 ACATGTTTGAGCGATTTAATGGG + Intergenic
953309835 3:41865670-41865692 CCTTCTTTGAGCCAAGTAATTGG - Intronic
955686504 3:61554228-61554250 GCATCTTTGTAAAAATCAATTGG + Intergenic
956088530 3:65639266-65639288 GCATCATTAAGAAAATGAATTGG - Intronic
957203683 3:77167135-77167157 TCATCTTTGAGTAAATTGACTGG + Intronic
959577592 3:107950900-107950922 GCATCTTTTAGCAAAATATTTGG - Intergenic
962295471 3:134180187-134180209 GCATCTTTGGGCCAATGAAGGGG + Intronic
963351425 3:144156579-144156601 TGATCTTTGGGCAACTTAATTGG + Intergenic
963375401 3:144457654-144457676 GCATCTTTGAACAACTTGAATGG - Intergenic
963670121 3:148241141-148241163 TCATCTTTGAGCAAATAGTTCGG + Intergenic
963840626 3:150102081-150102103 GCATCTTTGAGTTTATTGATTGG - Intergenic
963848357 3:150182313-150182335 GCATATATGGGCCAATTAATTGG + Intergenic
964517801 3:157531640-157531662 GCACATTTGAGGAAATTAAAAGG + Intronic
965299635 3:166993888-166993910 GCATCTGTGAGTTAATGAATAGG - Intergenic
965949329 3:174286498-174286520 ATATCATTTAGCAAATTAATGGG + Exonic
969511259 4:7619318-7619340 GCATCTTGGAGCATTTTTATTGG + Intronic
970541368 4:17083304-17083326 GAATTTTTGAACAAATGAATTGG - Intergenic
970753116 4:19389770-19389792 GCATCAATGAGGAAATTAAGAGG + Intergenic
971486051 4:27161504-27161526 GCATATTTGAGGAAATTAATCGG - Intergenic
972669623 4:41202369-41202391 GTTTCTTTAAGCAAACTAATTGG - Intronic
972698389 4:41470012-41470034 TCATCTTTGAGCATAATTATGGG + Intronic
974585192 4:63864900-63864922 ACATATGTGAGCAAATTATTTGG - Intergenic
975109072 4:70603439-70603461 GCCTTTTGGAGCAAATCAATTGG + Exonic
975248805 4:72152844-72152866 AAATATTTGAGCAAATTAACTGG + Intergenic
975613991 4:76228642-76228664 GCCTCCTTAAGCAAAATAATTGG - Intronic
977368584 4:96104305-96104327 ATATCTTTGACTAAATTAATGGG - Intergenic
978649197 4:110980129-110980151 GTATATTTGAGTAAATTTATAGG + Intergenic
979844257 4:125488705-125488727 GCATCTTTGAGAAAATCCTTTGG + Intronic
982079157 4:151770655-151770677 TCCTCTTTGAGAAAATTACTGGG - Intergenic
983530018 4:168801061-168801083 GCATCTCTGAGCAAGGTACTTGG - Intronic
986435873 5:7730463-7730485 GCATTGATGAGCAAATTAATTGG - Intronic
988900950 5:35731647-35731669 GCTTGTGTGAGCAAATTACTAGG + Intronic
989181756 5:38585254-38585276 TCATCTTTGAGCTAATTAAATGG - Intronic
989785192 5:45318644-45318666 TCATATTTTAGCAAAATAATGGG - Intronic
992588283 5:78264618-78264640 GCATCTTTTAAAAAATTATTGGG - Intronic
992887258 5:81170872-81170894 GCATTTTTGTGCCAATCAATGGG - Intronic
994386096 5:99134225-99134247 GCATGTGAGAGAAAATTAATGGG + Intergenic
995043402 5:107616115-107616137 GCATCTTTGATGAAGTCAATAGG + Intronic
995716858 5:115088930-115088952 GCAGCTTTGGGGAAAATAATTGG - Intergenic
996328578 5:122304941-122304963 GCAGCTTTTAGTGAATTAATAGG - Intergenic
1003990375 6:11480843-11480865 TCATCTTTAAGCAAGTTTATTGG + Intergenic
1004762351 6:18681691-18681713 GAATTTTTGAGCCAATTATTTGG - Intergenic
1005041326 6:21602903-21602925 GCATCCTTGAGAAAATGGATAGG - Intergenic
1006856226 6:37135085-37135107 GCAACTTTGAACAAATCACTTGG - Intergenic
1007268355 6:40615223-40615245 GCATTATTGAGAAAATGAATAGG - Intergenic
1008810032 6:55485268-55485290 ACATTTTAGAGCATATTAATTGG - Intronic
1011673304 6:89705241-89705263 GTATTTTTAAGCAAATTTATGGG + Intronic
1011872789 6:91917704-91917726 GGACATTTCAGCAAATTAATTGG + Intergenic
1012743569 6:103053874-103053896 GAATATTTATGCAAATTAATGGG - Intergenic
1013971822 6:116029215-116029237 GCATTTTTGAGAAAATTAGAAGG - Intronic
1015152989 6:130059461-130059483 GCATGTATGTGCAAATCAATAGG - Intronic
1015168750 6:130227943-130227965 GCATCCTTGGGCAAATCACTTGG - Intronic
1017349345 6:153421523-153421545 GTTTCTTTCAGTAAATTAATAGG - Intergenic
1017370414 6:153699544-153699566 GCAGCTTTCAGCAAACAAATAGG - Intergenic
1018750791 6:166803080-166803102 GAAACTTTGTGCAAACTAATTGG + Intronic
1021579367 7:22136380-22136402 ACCTCTTTGAGGAAAATAATAGG - Intronic
1024204495 7:47145315-47145337 GCATCTTTGAGCACAGCCATGGG - Intergenic
1027604151 7:80279364-80279386 GCATGTTTATGCAAAATAATGGG - Intergenic
1028510739 7:91623201-91623223 GCATCTTTGCACATAATAATTGG - Intergenic
1028672268 7:93415843-93415865 GCATCTTTGTCAAAATTAATTGG - Intergenic
1032536095 7:132665861-132665883 CCAACTTTGAGCTAATTCATTGG - Intronic
1033030981 7:137826613-137826635 AAATCATTGAACAAATTAATAGG - Intronic
1035539618 8:422681-422703 TCATCATTAAGAAAATTAATAGG + Intronic
1036258985 8:7225897-7225919 GGATGTTTTAGCAGATTAATCGG - Intergenic
1036307635 8:7613614-7613636 GGATGTTTTAGCAGATTAATCGG + Intergenic
1036311038 8:7684493-7684515 GGATGTTTTAGCAGATTAATCGG - Intergenic
1036358490 8:8061615-8061637 GGATGTTTTAGCAGATTAATCGG + Intergenic
1036391995 8:8331636-8331658 GGATCTTTTAGCAACATAATCGG + Intronic
1036618680 8:10407945-10407967 GAATCTTTGAGTAGGTTAATAGG + Intronic
1037551319 8:19974511-19974533 GCATATTTGAGCAGACTTATGGG + Intergenic
1040433085 8:47363142-47363164 GCATCTCTGAGGGAATTAAAAGG + Intronic
1040720793 8:50320283-50320305 GCAACTTTGTGCCAATAAATTGG - Intronic
1040975761 8:53193080-53193102 AAATCTTGGAGCAAATTTATAGG + Intergenic
1041853320 8:62418840-62418862 GGATCTATGAGCAAATAAAGCGG - Intronic
1044678720 8:94755568-94755590 GCATCTTTGAGCAAATTAATAGG - Intronic
1044870717 8:96617127-96617149 ACATTTTTGAGAAAATTAATAGG + Intergenic
1045806169 8:106164759-106164781 GAATCTATGAGCAAATTATTGGG + Intergenic
1045861431 8:106818750-106818772 GCTACTTTGAGAATATTAATAGG + Intergenic
1046395976 8:113640074-113640096 GCACCTTTGTCAAAATTAATTGG - Intergenic
1046444248 8:114295569-114295591 GCAACTCTAAGCAAATTCATAGG + Intergenic
1047695819 8:127402648-127402670 GCTCCTTTGAGCAAACTGATAGG - Intergenic
1051518971 9:17962656-17962678 GCTTCTTTGTGGAAATTCATTGG + Intergenic
1052568017 9:30183487-30183509 CCATGTTTGATCAAATTACTGGG + Intergenic
1054960857 9:70967649-70967671 GCTTCTGTGATCAAATTATTTGG + Intronic
1057436656 9:95046275-95046297 GCAAATTTGACCAACTTAATCGG + Intronic
1058758704 9:108108167-108108189 GTATGTTTGAGCAAGTTGATTGG + Intergenic
1060455829 9:123795211-123795233 GAATCTTTGAGCTAATTGAATGG - Intronic
1061739560 9:132690958-132690980 GCATTTTTGAGAAAATGTATTGG + Exonic
1062238882 9:135525514-135525536 GAATCTTTGAGCAACTTATCGGG - Intronic
1188317672 X:28694511-28694533 GGAGCTTTTAGCATATTAATTGG + Intronic
1193501413 X:82279346-82279368 GTATTTTTAAGCTAATTAATTGG - Intergenic
1195040518 X:101009898-101009920 GCATCTCTGAGCAAATGCACAGG + Exonic
1195570034 X:106388180-106388202 GCATGTTTGAGTAAATGTATGGG + Intergenic
1197551424 X:127897290-127897312 GGATCTTAGAGAATATTAATGGG + Intergenic
1199058086 X:143320829-143320851 GCTGCTCTGAGCACATTAATTGG + Intergenic
1202062596 Y:20903383-20903405 GCTTCTTTGAGCAAGATTATGGG + Intergenic