ID: 1044678724

View in Genome Browser
Species Human (GRCh38)
Location 8:94755592-94755614
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044678719_1044678724 2 Left 1044678719 8:94755567-94755589 CCCTATTAATTTGCTCAAAGATG 0: 1
1: 0
2: 0
3: 17
4: 237
Right 1044678724 8:94755592-94755614 GTATAGACAATGGTGGATCTGGG No data
1044678720_1044678724 1 Left 1044678720 8:94755568-94755590 CCTATTAATTTGCTCAAAGATGC 0: 1
1: 0
2: 4
3: 17
4: 204
Right 1044678724 8:94755592-94755614 GTATAGACAATGGTGGATCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr