ID: 1044684228

View in Genome Browser
Species Human (GRCh38)
Location 8:94811745-94811767
Sequence ATGGTTTAGCACCATCATCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044684228_1044684235 20 Left 1044684228 8:94811745-94811767 CCAAGATGATGGTGCTAAACCAT No data
Right 1044684235 8:94811788-94811810 TGATCCAGTTACCTCCCACTAGG 0: 11
1: 576
2: 3615
3: 9349
4: 11186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044684228 Original CRISPR ATGGTTTAGCACCATCATCT TGG (reversed) Intergenic
No off target data available for this crispr