ID: 1044688030

View in Genome Browser
Species Human (GRCh38)
Location 8:94846568-94846590
Sequence AAGAATAAGTAAAAAGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2062
Summary {0: 1, 1: 1, 2: 17, 3: 196, 4: 1847}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044688030_1044688035 21 Left 1044688030 8:94846568-94846590 CCAGCCTCTTTTTACTTATTCTT 0: 1
1: 1
2: 17
3: 196
4: 1847
Right 1044688035 8:94846612-94846634 AGTACAGTGTTCAGTAGAAGTGG No data
1044688030_1044688036 22 Left 1044688030 8:94846568-94846590 CCAGCCTCTTTTTACTTATTCTT 0: 1
1: 1
2: 17
3: 196
4: 1847
Right 1044688036 8:94846613-94846635 GTACAGTGTTCAGTAGAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044688030 Original CRISPR AAGAATAAGTAAAAAGAGGC TGG (reversed) Intronic
Too many off-targets to display for this crispr