ID: 1044693453

View in Genome Browser
Species Human (GRCh38)
Location 8:94900457-94900479
Sequence TAAGGGCCCTCCCTCTGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 96}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044693453_1044693459 29 Left 1044693453 8:94900457-94900479 CCACCTCAGAGGGAGGGCCCTTA 0: 1
1: 0
2: 0
3: 12
4: 96
Right 1044693459 8:94900509-94900531 TAGACAGCGCACCTCAGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044693453 Original CRISPR TAAGGGCCCTCCCTCTGAGG TGG (reversed) Intronic
901080499 1:6581147-6581169 GAGGGGCCCTCACTCTGAGCTGG - Exonic
901828768 1:11879630-11879652 CAAGGGCCCTCCCTATGACTGGG + Intergenic
904007169 1:27369442-27369464 TAAAGGGCCTCCCACTGTGGAGG + Exonic
905363955 1:37438719-37438741 AAAGAGGCCTCCCTCTGAAGGGG + Intergenic
906104413 1:43283312-43283334 AAAGAGCCCTGGCTCTGAGGAGG + Exonic
907918986 1:58895700-58895722 GAAGGGTACTTCCTCTGAGGAGG + Intergenic
909525342 1:76615903-76615925 TAAGGGCCATCTCTCTCAGAGGG - Intronic
910523334 1:88148735-88148757 CAAGCCTCCTCCCTCTGAGGTGG - Intergenic
911556142 1:99347252-99347274 TGAGGGCTCTGCCTCTGAGGAGG + Intergenic
914454173 1:147820245-147820267 CAAGGGCCGTCCCTCTGTAGAGG + Intergenic
920989478 1:210922892-210922914 TCAGGGACCTCCTTATGAGGAGG - Intronic
924931197 1:248733722-248733744 TAAGAGCCCTCCCTCTCAGCAGG + Intronic
1063528669 10:6809354-6809376 TAAGGGTCCTCTCTGTTAGGAGG - Intergenic
1064064493 10:12169383-12169405 AACAGCCCCTCCCTCTGAGGAGG - Intronic
1067836732 10:49646147-49646169 TAAGGGCCCTTCCACTGATGTGG + Intronic
1073639728 10:105239624-105239646 TAAGGGGCCTCCCTGTGGGCTGG + Intronic
1075680843 10:124330118-124330140 TAAGGGCCGTCGGTCTGAGCAGG - Intergenic
1076163759 10:128266046-128266068 TGAGGACCCTCACTCTGTGGGGG + Intergenic
1077286122 11:1766765-1766787 TTAGAGCCCTTCATCTGAGGGGG + Intergenic
1078645819 11:13140775-13140797 TGAGGGCCCTCTCTGTGAGTCGG + Intergenic
1079256823 11:18838039-18838061 AAAGGCCCCTCCCATTGAGGAGG - Intergenic
1079257112 11:18840748-18840770 AAAGGCCCCTCCCAGTGAGGAGG - Intergenic
1079418594 11:20264355-20264377 TCAGGGCCCAGTCTCTGAGGAGG - Intergenic
1085040335 11:73323123-73323145 GAAGTGCCCTGCCTCTCAGGGGG + Intronic
1090941132 11:131389263-131389285 CAAGGTCCCACCCTCTGAGGTGG - Intronic
1098454151 12:70653233-70653255 AAGGGGCCCTAACTCTGAGGGGG - Intronic
1099968387 12:89475237-89475259 TATGGGCCCTCCTGCTCAGGAGG - Intronic
1104010435 12:124926389-124926411 CAAGGGCCCTCCCTCGGGGCTGG + Intergenic
1106572003 13:30935289-30935311 TAAGGCCCCACCCTCTGACCAGG + Intronic
1107806939 13:44162105-44162127 TAAGGGGCCTTGCTCTGAGATGG - Intergenic
1113593141 13:111514543-111514565 TAAGAGCCCACGCTGTGAGGCGG + Intergenic
1118336342 14:64856328-64856350 GAAGGATCCTCCCTCTCAGGTGG - Intronic
1118388612 14:65277850-65277872 TAAGGGGCCCGCCTCTGGGGAGG - Intergenic
1119320325 14:73726569-73726591 GAGGGGCCCTCCCTCTGCTGGGG + Intronic
1121492052 14:94368056-94368078 CAAGGCCCCAGCCTCTGAGGAGG - Intergenic
1122300665 14:100729237-100729259 TAAAGTCCCTACCTCTGAGGAGG - Intronic
1122401344 14:101469360-101469382 CCAGGGCCTTCCCTGTGAGGTGG + Intergenic
1122774360 14:104110702-104110724 TAAGGGCCCTCCAGAGGAGGGGG + Intronic
1202868063 14_GL000225v1_random:135845-135867 TAGGGGCCCTTCCAGTGAGGTGG + Intergenic
1124006175 15:25797383-25797405 TCAGGGGACTCTCTCTGAGGGGG - Intronic
1124232143 15:27954890-27954912 GCAGGGCCCGCCCTCTGAGCGGG - Intronic
1128349117 15:66877339-66877361 TAAGGCCCCTACCCCTCAGGCGG - Intergenic
1129335814 15:74851509-74851531 TAAGGGCCCAGCCTCAGAAGGGG + Intronic
1130906312 15:88242997-88243019 ATAGGGCCCTCCCACGGAGGAGG + Intronic
1133330005 16:4966984-4967006 TAATGGACCTGCCTCTGAGCTGG - Intronic
1137949500 16:52770188-52770210 TAAGGGCTCTCCCTGTGGTGTGG - Intergenic
1138418355 16:56884272-56884294 TCAGGGCCCTCCAACTGGGGCGG - Intronic
1139550895 16:67672494-67672516 TAAGAGCCCTCCTGCAGAGGTGG - Intergenic
1143020307 17:3914143-3914165 CCAGTGCCCTCTCTCTGAGGAGG + Intronic
1147132059 17:38415443-38415465 TCATGCCCCTCCCTCTGAGGAGG + Intergenic
1151993542 17:77594019-77594041 TAAGGGTCCCCACACTGAGGTGG + Intergenic
1152648710 17:81482152-81482174 GCAGGGGCCTCCCTCTGGGGTGG + Intergenic
1152794763 17:82301524-82301546 TGAGGGCTCTCCCTGGGAGGAGG + Intergenic
1157867463 18:51198204-51198226 TTAAGGCCCTTCCTCTGAAGGGG - Intronic
1161717768 19:5886473-5886495 TGAGCGCCCACGCTCTGAGGAGG + Intronic
1165943375 19:39426623-39426645 TGTGGGTCCTCCCTCTGAGCCGG + Exonic
928883391 2:36122432-36122454 GGAGGGCCCTCCCACTGAGGAGG + Intergenic
933274178 2:80266274-80266296 TAAGGGACCTCCATGTGAGGAGG + Intronic
935207586 2:100909931-100909953 AAAGGGGCCTCCCTCTGCTGAGG + Intronic
943351785 2:186805459-186805481 TAAGGTCCCTGCCTCTGTGGAGG - Intergenic
944952159 2:204764117-204764139 TTGGGGCCCTCTCTCTGTGGTGG - Intronic
946829332 2:223712056-223712078 GAATGGCCCTGCCTCTTAGGAGG + Intergenic
948863976 2:240766197-240766219 TTAGGGCCATCACCCTGAGGTGG + Intronic
1174582672 20:51583437-51583459 CAGGAGGCCTCCCTCTGAGGTGG + Intergenic
1181596071 22:23915614-23915636 TAGGGCCCATCCCTCTGAGAGGG - Intergenic
1184245692 22:43234800-43234822 TGTGGGCCCTCCCTCTGCAGAGG + Intronic
1185076851 22:48687756-48687778 TAAGTGCCCCACCTCTGAGGGGG + Intronic
949915748 3:8963268-8963290 GGAGGTCCCTCCCTTTGAGGAGG - Intronic
950770559 3:15307512-15307534 TAAGAGCCCTCCCTATGGGATGG - Intronic
951538472 3:23760966-23760988 TAATGGCCCTCCCTCTGCTCAGG + Intergenic
953511108 3:43540255-43540277 CTAGGGCCCTTCCTCTGAGTAGG + Intronic
955374640 3:58384948-58384970 CTAGGGCCCTCCCTCTCTGGGGG - Intronic
963736523 3:149023290-149023312 AAAGTGTCCTCCCCCTGAGGAGG + Intronic
964469849 3:157041098-157041120 TAATTGCCCTCCCCCTGAGAAGG - Intronic
969899965 4:10339938-10339960 TAAATGTCTTCCCTCTGAGGAGG - Intergenic
972710299 4:41588751-41588773 TAAGGGGCCTCTCTCTGTGGCGG - Intronic
981757977 4:148162095-148162117 TAAGGGACTTTCCTCTTAGGTGG - Intronic
984821351 4:183885507-183885529 TGAGGCCCCTCCATCTGTGGAGG + Intronic
986856172 5:11871132-11871154 TGAGGGCCCCCCTTCTGAGCAGG - Intronic
993239437 5:85361731-85361753 TAAGGACAATCTCTCTGAGGAGG + Intergenic
997883942 5:137614261-137614283 TCAGGGCCCTGGCTCTGAGAGGG + Intergenic
998059363 5:139107224-139107246 TAAGAGCCCTCCTTCTGACATGG + Intronic
998417809 5:141958310-141958332 TAAGTGGCCTGCCGCTGAGGAGG + Exonic
1000164561 5:158635264-158635286 TCAGGACTCTCCCTCTGAGATGG - Intergenic
1012429003 6:99144604-99144626 GAAGGACCCTGCCTCTGGGGAGG + Intergenic
1014155943 6:118109907-118109929 TAAGGGCTTTCCCTCTGTGAGGG + Intronic
1017840810 6:158221668-158221690 TAAGGACTCTCCCTTTCAGGGGG - Intergenic
1024557129 7:50613447-50613469 AAAGGGCCCTGCCTCTGGAGGGG - Intronic
1029161463 7:98555461-98555483 CAAGGGCTCTCCTTCTCAGGTGG - Intergenic
1032606857 7:133364789-133364811 TAATGCCCCTGCCTGTGAGGAGG - Intronic
1035274211 7:157737697-157737719 CCAGGGCCCTTCCTCTGTGGAGG - Intronic
1037415462 8:18644908-18644930 TAAGGGGCCTGCATCTGATGAGG + Intronic
1038431933 8:27507386-27507408 TAAGAGGCTTCCCTCTGAGCTGG - Intronic
1039326734 8:36493551-36493573 CAAGGGAGCTACCTCTGAGGAGG + Intergenic
1044693453 8:94900457-94900479 TAAGGGCCCTCCCTCTGAGGTGG - Intronic
1046579913 8:116079256-116079278 GAAGTGGCCTCCCTCTTAGGTGG - Intergenic
1048457269 8:134589700-134589722 TCAGAGCCCTGCCTCTGGGGAGG - Intronic
1049171048 8:141160862-141160884 TAATGGCCTGCCCTCTGGGGCGG - Intronic
1049318228 8:141981038-141981060 CAAGGCCCCTTCCTCGGAGGAGG - Intergenic
1051333786 9:16048330-16048352 TGATGGGCCTCTCTCTGAGGAGG + Intronic
1053308904 9:37002897-37002919 TGAGGACCCTCGCTCTGCGGAGG + Intronic
1056480417 9:86997951-86997973 CAAGCCCCCTCTCTCTGAGGAGG + Intergenic
1061452802 9:130677739-130677761 TAAGGGGCCTGCTTCTGGGGTGG - Intronic
1062407094 9:136402031-136402053 TCATCGCCGTCCCTCTGAGGGGG + Exonic
1189587744 X:42477985-42478007 TAAGTGCCCTCCTTTTGAGGAGG + Intergenic
1190152078 X:47957221-47957243 AAAGGGCCCTCCCCAGGAGGTGG - Intronic
1190160583 X:48028928-48028950 AAAGGGCCCTCCCCAGGAGGTGG + Intronic
1201759708 Y:17523399-17523421 TAAGGGGGCTGCCTCTGAAGGGG + Intergenic
1201841846 Y:18382591-18382613 TAAGGGGGCTGCCTCTGAAGGGG - Intergenic