ID: 1044700253

View in Genome Browser
Species Human (GRCh38)
Location 8:94959159-94959181
Sequence TAACCTGTGAGTGATGGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044700249_1044700253 -1 Left 1044700249 8:94959137-94959159 CCAATGACTTACTCAGGTCACAT 0: 1
1: 0
2: 0
3: 9
4: 136
Right 1044700253 8:94959159-94959181 TAACCTGTGAGTGATGGGGCTGG No data
1044700247_1044700253 27 Left 1044700247 8:94959109-94959131 CCTGAGAAGGGATGGGATCAAGA 0: 1
1: 1
2: 1
3: 22
4: 182
Right 1044700253 8:94959159-94959181 TAACCTGTGAGTGATGGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044700253 Original CRISPR TAACCTGTGAGTGATGGGGC TGG Intronic
No off target data available for this crispr