ID: 1044709109

View in Genome Browser
Species Human (GRCh38)
Location 8:95038462-95038484
Sequence TAGCCCCAGCTACCCGGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 362
Summary {0: 1, 1: 0, 2: 5, 3: 37, 4: 319}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044709109_1044709116 28 Left 1044709109 8:95038462-95038484 CCAGGCCCGGGTAGCTGGGGCTA 0: 1
1: 0
2: 5
3: 37
4: 319
Right 1044709116 8:95038513-95038535 GTTTTTTTAATTTTTAGTACAGG No data
1044709109_1044709113 0 Left 1044709109 8:95038462-95038484 CCAGGCCCGGGTAGCTGGGGCTA 0: 1
1: 0
2: 5
3: 37
4: 319
Right 1044709113 8:95038485-95038507 CAGGCACATGCTACCACACCTGG 0: 65
1: 1649
2: 8569
3: 30522
4: 73925

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044709109 Original CRISPR TAGCCCCAGCTACCCGGGCC TGG (reversed) Intronic
902897401 1:19488387-19488409 TAGTCCCAGCTACTCAGGGCGGG - Intergenic
903974124 1:27138149-27138171 TAGCCCCAGGCCCACGGGCCTGG + Intronic
904221318 1:28972039-28972061 TAGTCCCAGCTACGGGGGCAGGG - Intronic
904495462 1:30884097-30884119 CAGCCACAGCTGCCCTGGCCAGG + Intronic
904530837 1:31168013-31168035 TAATCCCAGCTACCCCGGCGGGG + Intergenic
904707630 1:32403367-32403389 TAACCCCAGCTACTCGGGAGGGG - Intergenic
905162248 1:36046573-36046595 TAGTCCCAGCTACTCCAGCCTGG + Intronic
905683177 1:39889248-39889270 TAGCCCCATCTACTTGGGCAGGG + Intergenic
906087356 1:43147692-43147714 TTGCCCCAGCTCCTCAGGCCCGG - Intronic
907039334 1:51244504-51244526 TAGTCCCAGCTACTCGGGACAGG - Intronic
908322037 1:62987744-62987766 TAGACCCAGCTACTCGAGGCAGG + Intergenic
908544374 1:65148805-65148827 TAGCCCGAGCCACCCGGCCGAGG + Intronic
909334818 1:74460185-74460207 TAGTCCCAGCTACTCGAGGCAGG - Intronic
910277634 1:85465393-85465415 AAGCCACCGCTACCCGGACCTGG + Intronic
910693561 1:89989300-89989322 TAGTCCCAGCTACTCGGGGAGGG + Intergenic
910875693 1:91875766-91875788 TAATCCCAGCTACTCGGGCGGGG + Intronic
912773100 1:112483057-112483079 TAGTCCCAGCTACCTGGGAGTGG + Intronic
912929298 1:113942178-113942200 TAGTCCCAGCTACTCAGGACAGG - Intronic
913057757 1:115178010-115178032 TAGTCCCAGCTACTCAGGCAGGG + Intergenic
914710903 1:150212859-150212881 TAGTCCCAGCTACTCGAGGCAGG + Intergenic
914919562 1:151838282-151838304 CAGCCGCAGCCGCCCGGGCCCGG + Exonic
917184065 1:172332597-172332619 AAGCCCCAGCTGGCCGGGCATGG - Intronic
918290709 1:183105098-183105120 TAATCCCAGCTACCCTGGCTGGG + Intronic
920385870 1:205569697-205569719 TAGCCCCGGCTGCCGGGGGCGGG + Intronic
920561666 1:206943087-206943109 CAGCCCCAGCCACCCTGGGCTGG - Intronic
921934868 1:220786997-220787019 AACCCCGAGCCACCCGGGCCGGG - Exonic
923369344 1:233295288-233295310 TACCCACAGCTCCCCGGGACCGG + Intronic
924183827 1:241466109-241466131 TAGTCCCACCTACTTGGGCCAGG - Intergenic
924478527 1:244404711-244404733 TAGCCCCAGCTACTCGGGGCGGG - Intergenic
1063021384 10:2132422-2132444 TAGTCCCAGCTACTTGGTCCGGG + Intergenic
1064042593 10:11981067-11981089 TAATCCCAGCTACTCGGGCCTGG + Intronic
1064081375 10:12310721-12310743 TGGTCCCAGCTACTCGGGACAGG - Intergenic
1064100850 10:12462813-12462835 TAGTCCCAGCTACTCAGGGCAGG - Intronic
1066348352 10:34611944-34611966 TAGTCCCAGCTACTCGGGGCGGG - Intronic
1067297559 10:44983570-44983592 CAGCACTAGCTACCCTGGCCTGG + Intronic
1067936437 10:50616238-50616260 TAGTCCCAGCTACTTGGGGCGGG - Intronic
1069010203 10:63363804-63363826 TAGTCCCAGCTACCCGGGAGAGG - Intronic
1069566350 10:69465963-69465985 TAGCACCAGCTTCCCAGGGCAGG + Intronic
1069738537 10:70672952-70672974 TTGCCCCAGCCACCCGGGCAGGG + Intronic
1073311388 10:102545236-102545258 TAGTCCCAGCTACCCAGGGTGGG - Intronic
1073424293 10:103446960-103446982 AAGCCCCAGCCAGCAGGGCCAGG - Exonic
1075655590 10:124158986-124159008 TAAACCCAGCTACCAGGGGCAGG - Intergenic
1075999902 10:126905884-126905906 TACCCCCAACTCCCCGGCCCCGG + Intronic
1076151841 10:128168895-128168917 TAACCCCAGCTTCCAGGGCTTGG - Intergenic
1076660637 10:132053915-132053937 TAGTCCCAGCTACTCGGGTGGGG + Intergenic
1076707579 10:132310042-132310064 CATCCCCAACTGCCCGGGCCGGG - Intronic
1076839386 10:133038604-133038626 CAGCCCCAGCTCCCAGGCCCGGG + Intergenic
1077078679 11:712983-713005 TGGCCCCAGCTGGCCTGGCCTGG + Intronic
1078072315 11:8123841-8123863 TAGGCCCAGCTACTCATGCCTGG - Intronic
1078091828 11:8268698-8268720 GAGCAGCAGCTGCCCGGGCCGGG + Intronic
1080536810 11:33229904-33229926 TAGTCCCAGCTACTCGGGGGAGG + Intergenic
1080629034 11:34055445-34055467 TAACCCCAGCTACTCTGGGCGGG - Intronic
1081639155 11:44740895-44740917 TAGTCCCAGCTACTTGGGACAGG - Intronic
1081970030 11:47191839-47191861 TAGTCCCAGCTACTCAGGGCAGG + Intergenic
1082284098 11:50301351-50301373 TAATCCCAGCTACTTGGGCCTGG + Intergenic
1082767700 11:57182035-57182057 TGGGCCCAGCTTCCCTGGCCCGG + Exonic
1083041521 11:59691962-59691984 TAGCCCCAGCTACTCAGGATGGG - Intergenic
1083635465 11:64118320-64118342 CAGCCCCAGCTGCCCTGGCGTGG + Exonic
1083900846 11:65642564-65642586 GAGCCCCAGCTGCCTGCGCCTGG + Exonic
1084149550 11:67281763-67281785 TTGCCCCAGCCTCCCGTGCCTGG - Intronic
1084867678 11:72072920-72072942 TAGTCCCAGCTACTCGGGAGGGG + Intronic
1085109317 11:73873636-73873658 TAGTCCCAGCTACTCTGGCCAGG - Intronic
1087148328 11:94834465-94834487 TAGTCCCAGCTACTCGGGGTGGG + Intronic
1087295124 11:96363073-96363095 TAGTCCCAGCTACTCGAGGCAGG - Intronic
1087315649 11:96599525-96599547 TAATCCCAGCTACTCGGGCTCGG - Intergenic
1087838755 11:102901028-102901050 TAGTCCCAGCTACCCAGGCCTGG - Intergenic
1090283658 11:125480254-125480276 TAGTCCCAGCTACTCGGGGAGGG + Intronic
1092220657 12:6710850-6710872 TAGTCCCAGCTACTCAGGTCAGG + Intergenic
1093452823 12:19335149-19335171 TGGTCCCAGCTACTCGGGGCAGG - Intronic
1093931140 12:24956099-24956121 TAATCCCAGCTCCCCGGGGCGGG - Intergenic
1094550545 12:31446773-31446795 TAGTCCCAGCTACTCGGGGCAGG + Intronic
1095810768 12:46371928-46371950 AACCCCCAGCTCCCGGGGCCCGG - Intronic
1096192409 12:49628680-49628702 TAGTCCCAGCTACTCGGGAGAGG - Intronic
1096325119 12:50653456-50653478 TAGTACCAGCTACCCAGGGCTGG - Intronic
1096676187 12:53227398-53227420 GAGCCCTAGCTTCCGGGGCCTGG - Exonic
1098321525 12:69249138-69249160 TAGTCCCAGCTACTCGGGGGGGG + Intronic
1099280388 12:80637137-80637159 TAGTCCCAGCTACTCCAGCCTGG + Intronic
1100554025 12:95674027-95674049 TAGTCCCAGCTACCCGTGGAGGG + Intronic
1101662086 12:106774775-106774797 TAGCCCCTGCTTCGCCGGCCCGG - Exonic
1103359096 12:120342973-120342995 TGCCCCCAACTCCCCGGGCCCGG - Exonic
1103416863 12:120748100-120748122 TAGTCCCAGCTACTCGGGGCCGG + Intergenic
1103987903 12:124779738-124779760 CAGCCCCAGCCACCGGGGCAGGG - Intronic
1104014352 12:124952357-124952379 TGCCCCAAGCTACCCGGGCAGGG + Intronic
1104658988 12:130595436-130595458 TAGTCCCAGCTACTCAGGACAGG + Intronic
1104898496 12:132175736-132175758 GAGCCCCAGAAACCCAGGCCAGG - Intergenic
1105522214 13:21141011-21141033 TGGCCTCAGGGACCCGGGCCGGG + Intronic
1105682778 13:22746275-22746297 TAGTCCCAGCTACTCGGGGAGGG - Intergenic
1105929583 13:25040007-25040029 TAATCCCAGCTACTCGGGTCGGG + Intergenic
1106335366 13:28778416-28778438 AGGCCCCAGCTCCCTGGGCCAGG - Intergenic
1106534211 13:30624496-30624518 TAGCCCCAGCTACCCGGGAGGGG + Intronic
1107585401 13:41841664-41841686 TAGTCCCAGCTACTCGGGAGGGG + Intronic
1109708400 13:66130260-66130282 TAGTCCCAGCTACTCGGGAATGG - Intergenic
1110206440 13:72919847-72919869 TAGTCCCAGCTACCCTGCTCAGG + Intronic
1110549617 13:76797860-76797882 TAGTCCCAGCTACTGGGGACAGG - Intergenic
1111693619 13:91595135-91595157 TAGTCCCAGCTACTCGGGAGGGG - Intronic
1113555400 13:111230025-111230047 TAGCCCCAGCTGCTGGAGCCTGG + Intronic
1113724609 13:112588610-112588632 ACGTCCCAGTTACCCGGGCCGGG - Intergenic
1115123900 14:29970678-29970700 TAATCCCAGCTACTCGGGGCAGG - Intronic
1115906676 14:38209435-38209457 TCGCCGCAGCTGCCCGGGCTGGG - Exonic
1117147171 14:52846988-52847010 GGGCCACAGCGACCCGGGCCAGG - Intergenic
1117363650 14:55003389-55003411 TAGTCCCAGCTACTCGGGTTGGG + Intronic
1117703085 14:58434906-58434928 TAGTCCCAGCTACTCTGGCGGGG - Intronic
1118137645 14:63046156-63046178 TGGCCCCTGCGACCCGGGCCGGG + Intronic
1118675878 14:68183970-68183992 TAGTCCCAGCTACTCGGGGGGGG + Intronic
1119351762 14:73971638-73971660 TAGTCCCAGCTACTCAGGGCGGG - Intronic
1119532637 14:75373750-75373772 TAGCCCCAGCTACCCAGACCTGG + Intergenic
1122096404 14:99376280-99376302 TAGTCCCAGCTACTGGGGGCGGG + Intergenic
1122409905 14:101520583-101520605 GAATCCCAGCTACCAGGGCCGGG + Intergenic
1122960527 14:105091926-105091948 GAACCCCAGCTCCCAGGGCCTGG + Intergenic
1125781056 15:42268545-42268567 TAGTCCCAGCTACTCAGGCAAGG + Intronic
1127159533 15:56166863-56166885 TCGCCCCAGCTACTCAGGCTGGG - Intronic
1127287200 15:57542252-57542274 CAGCCCCAGACACCAGGGCCTGG - Intronic
1128510239 15:68309708-68309730 TAGTCCCAGCGACTCGGGCTGGG - Intronic
1130261647 15:82359092-82359114 TAGTCCCAGCTACTCGGGAGAGG - Intergenic
1130279588 15:82509920-82509942 TAGTCCCAGCTACTCGGGAGAGG + Intergenic
1130470967 15:84226103-84226125 TAGTCCCAGCTACTCGGGAGAGG + Intergenic
1130478461 15:84340673-84340695 TAGTCCCAGCTACTCGGGAGAGG + Intergenic
1130493309 15:84447459-84447481 TAGTCCCAGCTACTCGGGAGAGG - Intergenic
1130593256 15:85230741-85230763 TAGTCCCAGCTACTCGGGAGAGG + Intergenic
1131015315 15:89053084-89053106 TAGTCCCAGCTACTCGGGGGTGG - Intergenic
1131096059 15:89655044-89655066 CAGCCCCAGCTGCCCTGCCCCGG - Intronic
1132767714 16:1542854-1542876 TAGACCCAGCAACCTGGGACAGG + Intronic
1132780880 16:1624698-1624720 TAGTCCCAGCTACTCGGGAGGGG - Intronic
1133238408 16:4400511-4400533 TAATCCCAGCTACTCGGGACGGG + Intronic
1133486884 16:6228189-6228211 TATTCCCAGCTACTCGGGGCCGG + Intronic
1135769600 16:25207085-25207107 TAGCCCCAGTTACTGGGGCTGGG - Intergenic
1136114678 16:28087279-28087301 TTGCCCCTGCTGCCCTGGCCTGG - Intergenic
1136567792 16:31080431-31080453 TGGCCGCAGCTTCCCTGGCCGGG + Exonic
1137493213 16:48950253-48950275 TGGCCCCACCTACCCAAGCCTGG + Intergenic
1138036594 16:53613436-53613458 TAGTCCCAGCTACCAGGGGGAGG - Intronic
1138449752 16:57086659-57086681 TAGTCCCAGCTACTCGGGGCGGG + Intergenic
1139629397 16:68219440-68219462 TAGTCCCAGCTACTTGGGGCAGG + Intronic
1139702980 16:68720739-68720761 TAATCCCAGCTACTCGGGCTTGG - Intronic
1139792580 16:69451829-69451851 TAGTCCCAGCTACTCGGGGCAGG + Intronic
1139819259 16:69707558-69707580 TAGTCCCAGCTACTCGGGGTAGG - Intronic
1139893913 16:70272799-70272821 TAGTCCCAGCTACTCGGGAGAGG + Intronic
1140097021 16:71883993-71884015 CAGCCCAAGCCAGCCGGGCCGGG + Exonic
1142131416 16:88433180-88433202 CAGCTCCAGCTCCCAGGGCCTGG + Exonic
1142280540 16:89145542-89145564 TAGCCCCATGTTCCCTGGCCAGG - Intronic
1142730862 17:1856207-1856229 TGGTCCCAGCTACCTGAGCCCGG + Intronic
1142764477 17:2057639-2057661 TCGCCATAGCTACCCAGGCCCGG - Exonic
1143560725 17:7692871-7692893 TAGTCCCAGCTACTCGGGAGAGG - Intronic
1143651786 17:8267722-8267744 TAGCCCCATCTTCCTGGGCTGGG + Intronic
1143869807 17:9949981-9950003 TAATCCCAGCTACCCGGGAGAGG - Intronic
1144564494 17:16348802-16348824 TTGCCCCAGCTCCTCGGCCCTGG - Intronic
1146513327 17:33469367-33469389 TAGGCCCAGCTGCACAGGCCAGG - Intronic
1146519616 17:33515975-33515997 TAGTCCCAGCTACTTGGGGCGGG + Intronic
1148085426 17:44990944-44990966 TAGTCCCAGCTACTCGGGAGTGG + Intergenic
1149658884 17:58324384-58324406 TGGCCCCAGCTACCCGGGGGCGG - Intronic
1150186313 17:63185208-63185230 TAGTCCCAGCTATTCGAGCCTGG - Intronic
1150747313 17:67825979-67826001 CAGCACCAGCGCCCCGGGCCGGG + Exonic
1150875749 17:68968619-68968641 TAGTCCCAGCTACTCGGGGGGGG - Intergenic
1151911221 17:77084604-77084626 TAGTCCCAGCTGCTGGGGCCAGG + Intergenic
1152361485 17:79835077-79835099 CAGCCCCACCTGCCCGGACCTGG - Exonic
1152406108 17:80098817-80098839 TAATCTCAGCTACCCGGGCGTGG + Intronic
1152406500 17:80101223-80101245 TGGCCCCCGCTGCCCCGGCCTGG - Intergenic
1152757318 17:82092442-82092464 CAGCCCCACCTACCTTGGCCAGG + Exonic
1153515412 18:5896224-5896246 GAGCCCCAGCTGCCGGGTCCCGG - Intergenic
1153862183 18:9223373-9223395 TAGTCCCAGCTACTCGGGGGAGG - Intronic
1155152279 18:23132841-23132863 TAGTCCCAGCTACTCGGGGGGGG + Intergenic
1156366114 18:36428830-36428852 TGGCCACAGCTAACCGGACCAGG - Intronic
1158387469 18:57012073-57012095 TTTCCCCAGATACCCAGGCCAGG - Intronic
1158569330 18:58583692-58583714 TAGTCCCAGCTACTCCAGCCTGG + Intronic
1158723605 18:59948014-59948036 TAGTCCTAGCTACTCAGGCCAGG + Intergenic
1158997982 18:62943130-62943152 TACCCCCAGTGACCCGTGCCAGG + Intronic
1160147912 18:76379340-76379362 AAGCCCCCGCCACCCGGGGCAGG + Exonic
1161328461 19:3674622-3674644 TAGTCCCAGCTACTCGGGGGAGG - Intronic
1161658202 19:5529102-5529124 TAGTCCCAGCTACTCGGGGGAGG - Intergenic
1161709646 19:5840888-5840910 TAGTCCCAGCTACTTGGGGCAGG - Intergenic
1161851727 19:6740775-6740797 AGGCCCCAGCCACCCCGGCCGGG - Intronic
1162411921 19:10511347-10511369 TAGCCCCAGCTACTCGGGTTGGG + Intergenic
1162767930 19:12931209-12931231 TAGTCCCAGCTACTCGGGACTGG - Intronic
1162771250 19:12950519-12950541 TAGTCCCAGCTACTCGGGCGGGG - Intronic
1162963608 19:14144319-14144341 TAGTCCCAGGTACTCGGGACTGG - Intergenic
1163127186 19:15250647-15250669 TAACCTCAGCTACCTGGGCTGGG - Intronic
1163522454 19:17799608-17799630 TGGCCCCAGCTACTCGGCCCAGG + Intronic
1164592972 19:29516270-29516292 CAGCCCCAGCTCCCCAGGCACGG + Intergenic
1164631858 19:29767085-29767107 TGACCCCAGCTACCTGGGCTGGG - Intergenic
1164706978 19:30326985-30327007 TAGTCCCAGCTACTCAGGCGCGG + Intronic
1165685813 19:37818644-37818666 TAGTCCCAGCTACTCGGACTGGG - Intergenic
1167015523 19:46838599-46838621 GAGCCCCAGCTTCCAGGGTCCGG - Intronic
1167064943 19:47178119-47178141 TAGTCCCAGCTACTCGGGAGGGG + Intronic
1167065356 19:47181596-47181618 TAGTCCCAGCTACCTGGGAGGGG - Intronic
1167610680 19:50506497-50506519 CAGCCCCAGCGACACGGGCGAGG + Exonic
1168173704 19:54607959-54607981 CAGCCCCAGCTGCCCGGGGGTGG - Intronic
1168643895 19:58047598-58047620 GAGCCCCACCAACCCGAGCCAGG - Intronic
925015850 2:523656-523678 CAGCCCCAGAGACCAGGGCCAGG + Intergenic
925585551 2:5460821-5460843 TGGCCCCAGCAACCCGGTCATGG - Intergenic
925925191 2:8665115-8665137 TAGTCCCAGCTACTCGGGTGGGG + Intergenic
926224774 2:10959724-10959746 TAGTCCCAGCTACTCGGGAGAGG + Intergenic
926356668 2:12047056-12047078 TAGTCCCAGCTACTCGGGGGAGG - Intergenic
928546628 2:32334928-32334950 TAGTCCCAGCTACTCGGGGGCGG + Intergenic
929202626 2:39253251-39253273 TAGTCCCAGCTACTCGGGAGAGG - Intronic
929962726 2:46508554-46508576 TAGTCCCAGCTACTCAGGACTGG + Intronic
930797050 2:55404849-55404871 TAACCCCAGCTACTCGGGGGAGG - Intronic
930825506 2:55693280-55693302 GAGCCCCAGCTTCCAGGGTCCGG + Intronic
932020028 2:68075065-68075087 TAGTCCCAGCTACTTGGGCGGGG + Intronic
934735066 2:96685911-96685933 CAGCCCCTGCTACCCTGTCCTGG + Intergenic
936116666 2:109708264-109708286 TAGTCCCAGCTACTTGAGCCTGG + Intergenic
938073657 2:128320851-128320873 TTGCCCCAGCTCCCTAGGCCAGG + Intergenic
938075465 2:128330982-128331004 TAGTCCCAGCTACTCGAGGCAGG - Intergenic
938727622 2:134121228-134121250 TAGCCCCTGCTCCCCGTGGCGGG + Intronic
939067647 2:137503903-137503925 TAGTCCCAGCTACCTGGGGGAGG + Intronic
939783433 2:146477914-146477936 TATCACCAGCTTCCCGGACCAGG + Intergenic
940300752 2:152174719-152174741 TAGTCCCAGCTACTCGGGAAGGG + Intronic
941786914 2:169506922-169506944 TAGTCCCAGCTACCTGGGAGGGG + Intronic
941819135 2:169827553-169827575 CAGCCCGAGCTGCCCGCGCCGGG + Exonic
941864486 2:170320157-170320179 TAGTCCCAGCTACTTGGGGCGGG - Intronic
943147973 2:184069658-184069680 TAGTCCCAGCTACTCGGGGGAGG + Intergenic
946785122 2:223235311-223235333 TAGTCCCAGCTACTCGGGGTGGG + Intergenic
948909522 2:240996150-240996172 AACCCCCAGCTCCCCGGGCCCGG + Intergenic
1170746687 20:19105859-19105881 TAGCTCCAGCTGCCTGGCCCAGG - Intergenic
1171423579 20:25035012-25035034 TAGTCCCAGCTACTCCGGCTGGG - Intronic
1172705561 20:36879747-36879769 TAGTCCCAGCAACTGGGGCCAGG + Intronic
1173390438 20:42627387-42627409 TAGTCCCAGCTACATGGGCATGG - Intronic
1173723706 20:45282010-45282032 TAGTCCCAGCTACTCGGGTAAGG + Intergenic
1174018134 20:47505922-47505944 TAGTCCCAGCTACTCGGGCAGGG - Intronic
1174379147 20:50145573-50145595 TAGTCCCAGCTACTCGGGAGAGG + Intronic
1175030368 20:55947443-55947465 TAGTCCCAGCTACTCGGGAGAGG + Intergenic
1175294303 20:57897781-57897803 CAGCCCGAGCTTCCCGGGACAGG - Intergenic
1176004580 20:62853467-62853489 TAGTCCCAGCTGCTCGGGGCGGG - Intronic
1177457155 21:21355313-21355335 TAGTTCCAGCTACTCGGGACGGG + Intronic
1180784047 22:18537091-18537113 TCGCCCCAGCTCCCTGGGGCCGG + Intergenic
1181044534 22:20208272-20208294 TGGCCCCACCTGCCAGGGCCTGG - Intergenic
1181240948 22:21476443-21476465 TCGCCCCAGCTCCCTGGGGCCGG + Intergenic
1181541883 22:23578001-23578023 TAGTCCCAGCTACTCGGGAGGGG - Intronic
1183250876 22:36729559-36729581 TAGCTCCAGCTTCCCAGGCTTGG + Intergenic
1183440149 22:37818363-37818385 TGGCCACAGCTACCCCAGCCAGG - Intergenic
1183924853 22:41198344-41198366 TAGTCCCAGCTACTGGGGCGGGG + Intergenic
1184357535 22:43992552-43992574 GGGGCCCAGCTACCCGGGCTTGG + Intronic
1184755541 22:46513912-46513934 TAGTCCCAGCTACTCGGGGGGGG - Intronic
1185142969 22:49113504-49113526 GGGCCTCAGCTACCCAGGCCTGG + Intergenic
1185244389 22:49765513-49765535 TGGCTCCAGCTACTCGTGCCAGG + Intergenic
950438426 3:12994005-12994027 CAGCCCCAGCGACCCCCGCCCGG + Intronic
950496591 3:13337718-13337740 AGGCCCTAGATACCCGGGCCAGG + Intronic
950578489 3:13847237-13847259 TAGGCCCAGACACCCTGGCCTGG + Intronic
950704756 3:14772908-14772930 AAGCCCCAGCACCCCGGGCCGGG - Exonic
953024308 3:39135933-39135955 TAGTCCCAGCTACTCGGGGGTGG + Intronic
953226107 3:41022862-41022884 TAGTTCCAGCTACTCGGGACCGG - Intergenic
953284527 3:41593911-41593933 TAGTCCCAGCTACCGGGGTTGGG + Intronic
954316793 3:49805842-49805864 TAGCCCCAGCCTCCAGGGACTGG + Intronic
954391564 3:50270498-50270520 GAGTGCCAGCTGCCCGGGCCGGG + Intronic
954416929 3:50397886-50397908 TAGCCCCACCTACCTGGCCCAGG + Intronic
954562940 3:51573589-51573611 TAGTCCCACCTACTCGGGCGTGG - Intronic
954721616 3:52569010-52569032 TAGTCCCAGCTACCCGGAGTAGG - Intronic
955770274 3:62378437-62378459 GAGCCCCAGATACCCGAGGCTGG + Intergenic
956440656 3:69277649-69277671 TAGTCCCAGCTACTCGGGACGGG - Intronic
958490798 3:94769531-94769553 TAGTCCCAGCTACTCGGGGCAGG + Intergenic
959663684 3:108897697-108897719 TAGTCCCAGCTACTCGGGAGGGG - Intergenic
959714801 3:109421236-109421258 TAGTCCCAGCTACTCCAGCCTGG - Intergenic
961042798 3:123689176-123689198 TGTCCCCAGCCACCCTGGCCAGG - Intronic
961181195 3:124879159-124879181 TAGCCCCAACAACCCAAGCCAGG + Intronic
963730626 3:148967772-148967794 TAATCCCAGCTACTCGGGGCTGG + Intergenic
963739212 3:149058189-149058211 TAGTCCCAGCTACTTGAGCCTGG - Intronic
965597644 3:170423900-170423922 TAATCCCAGCTACTCGGGGCGGG + Intronic
969553519 4:7889426-7889448 TAGCCCCAGCTACTCGGGAGAGG + Intronic
970492113 4:16585198-16585220 TAGCCCCAGCTACCCTGGCTGGG + Intronic
975641760 4:76507656-76507678 TAGTCCCAGCTACTCGGGAGGGG - Intronic
977696960 4:99976340-99976362 TAGTCCCAGCTACTCGGGGTTGG + Intergenic
977836603 4:101652602-101652624 TAGTCCCAGCTACTCGGGACAGG + Intronic
977938992 4:102837830-102837852 TAGTCCCAGCTACTCGGGAGAGG + Intronic
978743582 4:112166166-112166188 TAGTCCCAGCTACTCGGGAGAGG - Intronic
979666700 4:123318665-123318687 TAGTCCCAGCTACTCGGTCGGGG + Exonic
982870277 4:160570844-160570866 TAGTCCCAGCTACTCGGGAGGGG + Intergenic
983300837 4:165923551-165923573 TAGTCCCAGCTACTCAGGACAGG - Intronic
984980892 4:185280047-185280069 TAGTCCCAGCTACTTGGGACTGG - Intronic
985000308 4:185475792-185475814 TAGTCCCAGCTACTTGGGCTTGG + Intergenic
986307819 5:6528732-6528754 CACCCTCAGCTTCCCGGGCCAGG + Intergenic
987306808 5:16644929-16644951 TAGCCCCAGCTACTTGGCTCAGG - Intergenic
988845007 5:35118912-35118934 TAGTCCCAGCTACTTGGGGCAGG - Intronic
989155377 5:38339999-38340021 TATCCCCAGCCACCCCAGCCTGG + Intronic
989608463 5:43269015-43269037 TAGCCACTCCTACCCGGGCACGG + Intronic
990430778 5:55733349-55733371 TAGTCCCAGCTACTCGAGGCAGG - Intronic
993984294 5:94579039-94579061 TAGTCCCAGCTACGGGGGCGGGG - Intronic
997982847 5:138480413-138480435 TAGTCCCAGCTACTCGGGAATGG - Intergenic
998331823 5:141334455-141334477 TAGTCCCAGCTACGCGGGGCGGG + Intronic
998408301 5:141887471-141887493 TAGTCCCAGCTACTCCAGCCTGG - Intergenic
1001108086 5:168872758-168872780 TAGTCCCAGCTACTCGGGAGAGG - Intronic
1001425498 5:171619521-171619543 AAGCCCCACCTACCCCGCCCAGG - Intergenic
1001819719 5:174700518-174700540 TAGTCCCAGCTACTCGAGGCAGG - Intergenic
1002896999 6:1385050-1385072 TAGCCCCAGATCTCCTGGCCTGG - Intergenic
1003241436 6:4349028-4349050 TAGTCCCAGCTACTCGGGAGAGG - Intergenic
1004988544 6:21110846-21110868 TAGTCCTAGCTACCGGGGACAGG + Intronic
1005755304 6:28920745-28920767 TACCCCCAGCCTCCCAGGCCAGG - Intronic
1006327872 6:33367433-33367455 AAGCCCCAGCTAACAAGGCCAGG - Intergenic
1006411882 6:33878531-33878553 TAGCCCCTCCTTCCCAGGCCTGG - Intergenic
1006689261 6:35866463-35866485 TAGTCCCAGCTACGCGGGAAGGG + Intronic
1007693210 6:43716147-43716169 TTGGCCCAGCTCCCAGGGCCTGG + Intergenic
1011531009 6:88321007-88321029 TAGTCCCAGCTACCTGGGGTGGG - Intergenic
1012284638 6:97374185-97374207 TAGTCCCAGCTACTCGGGAGGGG - Intergenic
1013074448 6:106758839-106758861 TAGTCCCAGCTACTCAGGCATGG - Intergenic
1013152287 6:107458367-107458389 TAGTCCCAGCTACTCCCGCCTGG + Intronic
1013369801 6:109458848-109458870 CAGCCACAGCTTCCCGGCCCAGG - Intergenic
1014098215 6:117482708-117482730 GAGCCGCAGCTGCCCGGGCCGGG - Exonic
1014259494 6:119199790-119199812 TAGTCCCAGCTACTCGGGGCGGG + Intronic
1016220877 6:141668621-141668643 CTGCTCCAGCTACCCGGGCATGG - Intergenic
1016464040 6:144308407-144308429 TAGCCCCAGCTACCCGAGGGTGG - Intronic
1016982150 6:149863731-149863753 TAGCCGCCGCTGCCCGGGCCCGG + Exonic
1017060651 6:150481714-150481736 TAGACCCAGCTACTTGGGCTAGG + Intergenic
1017127272 6:151077929-151077951 TAGCCCCAGCTACTCCGGAGAGG + Intronic
1017838238 6:158199955-158199977 TAGTCCCAGCTACTGGGGCTGGG + Intergenic
1017881800 6:158567245-158567267 TCGGCCCAGCTACCCAGGCCAGG - Intronic
1018306440 6:162461699-162461721 TAACCCCAGCTACTCGGGGCGGG + Intronic
1018625871 6:165778188-165778210 TAGTCCCAGCTACTCGGGAGAGG - Intronic
1019004041 6:168781311-168781333 TAGTCCCAGCTACTTGGGACTGG + Intergenic
1019550482 7:1599826-1599848 TAGTCCCAGCCACCAGGACCGGG - Intergenic
1023882330 7:44327431-44327453 CAGCCCCAGCTATGTGGGCCAGG + Intronic
1024274546 7:47667302-47667324 TAGTCCCAGCTACTCCAGCCTGG + Intergenic
1025188829 7:56881483-56881505 TAATCCCAGCTACTTGGGCCTGG - Intergenic
1025683107 7:63695437-63695459 TAATCCCAGCTACTTGGGCCTGG + Intergenic
1026742352 7:72986826-72986848 TAGTCCCAGCTACTCAGGCATGG + Intergenic
1026802200 7:73407248-73407270 TAGTCCCAGCTACTCAGGCATGG + Intergenic
1027028474 7:74871560-74871582 TAGTCCCAGCTACTCAGGCATGG + Intergenic
1027101383 7:75378252-75378274 TAGTCCCAGCTACTCAGGCATGG - Intergenic
1027150083 7:75727224-75727246 TAGTCCCAGCTACTCGGCCTAGG - Intronic
1029483756 7:100827321-100827343 CAGCCCCCGCCACCCGGGGCGGG - Exonic
1029572007 7:101376190-101376212 TAGTCCCAGCTACCTGGGAGGGG + Intronic
1031047038 7:116902827-116902849 TAGTCCCAGCTACTCAGCCCAGG - Intronic
1032573942 7:133032309-133032331 TAGCCACAGTTACCCCTGCCAGG - Intronic
1033342469 7:140502739-140502761 TAATCCCAGCTACTCGGGCAGGG + Intergenic
1033825557 7:145185882-145185904 TAGTCCCAGCTACTCGGGGGGGG + Intergenic
1035156691 7:156920204-156920226 CAGCCCAAGTGACCCGGGCCAGG + Intergenic
1035449721 7:158968861-158968883 TGGTCCCAGCTACTCGGGGCTGG + Intergenic
1043952020 8:86320070-86320092 TAGTCCCAGCTACCCAGCCCTGG - Intronic
1044709109 8:95038462-95038484 TAGCCCCAGCTACCCGGGCCTGG - Intronic
1047416409 8:124667951-124667973 TAGTCCCAGCTACTAGGGCAGGG + Intronic
1049156406 8:141069546-141069568 TAGTCCCAGCTACTCAGGCGGGG - Intergenic
1049212082 8:141391592-141391614 TGACCCCAAGTACCCGGGCCAGG + Intergenic
1049542219 8:143213777-143213799 AAGCCTCAGCTACCCGGGTATGG - Intergenic
1049583068 8:143421469-143421491 TTGCCCCTGCTCCCCCGGCCGGG - Intronic
1049643853 8:143727512-143727534 TTGCCGCCGCTGCCCGGGCCTGG + Exonic
1049799564 8:144511532-144511554 AAGCCCCTGCTACCCGGCCCAGG - Exonic
1051010955 9:12413500-12413522 GAGTCCCAGCTACTTGGGCCTGG + Intergenic
1051130182 9:13851693-13851715 TAGTCCCAGCTACTCGGGGGAGG + Intergenic
1051263102 9:15285143-15285165 TAGTCCCAGCTACTCGGGGCGGG + Intronic
1051288264 9:15518538-15518560 TAGTCCCAGCTACTCCGGCTGGG - Intergenic
1052535230 9:29737831-29737853 TAGCCCCAGCTACTCAGGAGAGG + Intergenic
1053226171 9:36359866-36359888 TAGTCCCAGCTACTCGGGGCGGG - Intronic
1053312144 9:37026855-37026877 TGGCCGCAGCTACCCCGGGCTGG - Intronic
1057093055 9:92277556-92277578 TAGTCCCAGCTACTCGGGATGGG + Intronic
1057352395 9:94309896-94309918 TAGTCCCAGCTACCTGTGGCAGG + Intergenic
1057655245 9:96946176-96946198 TAGTCCCAGCTACCTGTGGCAGG - Exonic
1060178053 9:121512031-121512053 TAGTCCCAGCTACTCGGGGAGGG - Intergenic
1060522677 9:124302642-124302664 TACCCCATGCTGCCCGGGCCTGG + Intronic
1060603202 9:124891762-124891784 TAGTCCCAGCTACTCGGGAGGGG - Intronic
1060731495 9:126039702-126039724 CAGCCTCAGCTCCCCGGGCTGGG + Intergenic
1061162786 9:128905051-128905073 TAGCCCCAGCTACCTGGGGGAGG + Intronic
1061742113 9:132714853-132714875 TAGTCCCAGCTACTCGGGAGAGG + Intergenic
1061919723 9:133776209-133776231 TAGCCCCAGCGCCCCTGGCCTGG + Intronic
1062050415 9:134444101-134444123 TAGGCCCAGGTTCCAGGGCCTGG + Intergenic
1185612074 X:1398763-1398785 CAGCCCCTGCCACCCGGGGCGGG - Intergenic
1185641576 X:1591832-1591854 AAGCCCCGGCCCCCCGGGCCCGG - Intronic
1190225921 X:48544881-48544903 TGGCATCAGCTACCTGGGCCGGG + Exonic
1192168158 X:68838839-68838861 CAGCCCCAACTACATGGGCCTGG + Exonic
1195404983 X:104502910-104502932 TAGGCCCAGCTACCCTGTGCAGG - Intergenic
1195411630 X:104572717-104572739 TAGTCCCAGCTACTGGGGGCGGG - Intronic
1196434340 X:115661329-115661351 TAGTCCCAGCTACTCGGGTGGGG + Intergenic
1196912091 X:120493969-120493991 TAGTCCCAGCTACTCGAACCTGG + Intergenic
1197211112 X:123828851-123828873 TAGTCCCAGCTACTCGGGTGAGG + Intergenic
1199692552 X:150319705-150319727 GAACCCCACCTACCAGGGCCAGG - Intergenic
1200203729 X:154300810-154300832 TAGTCCCAGCTACTCGGGTAAGG - Intronic
1201239808 Y:11947755-11947777 TAGTCCCAGCTACTCGGGAGAGG - Intergenic