ID: 1044713857

View in Genome Browser
Species Human (GRCh38)
Location 8:95082340-95082362
Sequence GTGCAGCAATGGTAGGAAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044713852_1044713857 15 Left 1044713852 8:95082302-95082324 CCCTGTCTCATTAAAAAAATAAA 0: 5
1: 93
2: 1034
3: 20044
4: 36530
Right 1044713857 8:95082340-95082362 GTGCAGCAATGGTAGGAAATGGG No data
1044713853_1044713857 14 Left 1044713853 8:95082303-95082325 CCTGTCTCATTAAAAAAATAAAA 0: 3
1: 82
2: 709
3: 19338
4: 35356
Right 1044713857 8:95082340-95082362 GTGCAGCAATGGTAGGAAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044713857 Original CRISPR GTGCAGCAATGGTAGGAAAT GGG Intronic
No off target data available for this crispr