ID: 1044716277

View in Genome Browser
Species Human (GRCh38)
Location 8:95102645-95102667
Sequence CACCTCCCTCAGGTACCCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 171}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044716277_1044716286 19 Left 1044716277 8:95102645-95102667 CCCATGGGTACCTGAGGGAGGTG 0: 1
1: 0
2: 0
3: 11
4: 171
Right 1044716286 8:95102687-95102709 CTGAAGGAGCCAGGTGCTAGAGG No data
1044716277_1044716285 10 Left 1044716277 8:95102645-95102667 CCCATGGGTACCTGAGGGAGGTG 0: 1
1: 0
2: 0
3: 11
4: 171
Right 1044716285 8:95102678-95102700 CTGCTGGTACTGAAGGAGCCAGG No data
1044716277_1044716284 3 Left 1044716277 8:95102645-95102667 CCCATGGGTACCTGAGGGAGGTG 0: 1
1: 0
2: 0
3: 11
4: 171
Right 1044716284 8:95102671-95102693 TGGTAAGCTGCTGGTACTGAAGG No data
1044716277_1044716281 -6 Left 1044716277 8:95102645-95102667 CCCATGGGTACCTGAGGGAGGTG 0: 1
1: 0
2: 0
3: 11
4: 171
Right 1044716281 8:95102662-95102684 GAGGTGCCCTGGTAAGCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044716277 Original CRISPR CACCTCCCTCAGGTACCCAT GGG (reversed) Intronic
900938502 1:5782276-5782298 CCCCTCCCTCAGTTCCTCATAGG - Intergenic
900979352 1:6037494-6037516 CACGTCCCTCAGCTACTCAGGGG + Intronic
902640849 1:17765192-17765214 CACCACACTCAGGGACCCAGAGG - Intronic
903485110 1:23684053-23684075 CTCCACCCTCAAGTACCCACTGG - Intergenic
904092791 1:27956919-27956941 CACCTCCCCAAGATACCCACTGG - Intronic
907763776 1:57388370-57388392 CTCCTCCCTCAGAGTCCCATGGG + Intronic
909560855 1:77007885-77007907 GCCCTCCCTCAGGTAGCTATGGG - Intronic
910422615 1:87083120-87083142 CCCCTCCCTCACCTACCAATAGG + Intronic
910579699 1:88809729-88809751 CTCCTGCCTCAGCTTCCCATTGG + Intronic
913253463 1:116932165-116932187 CACCTCCTTCTGATATCCATGGG - Intronic
914167662 1:145189318-145189340 CCCCTCCCTCAGTTCCTCATAGG - Intergenic
914787721 1:150849818-150849840 CACCTGCCTCAGCTTCCCAAAGG - Intronic
915481037 1:156185228-156185250 CACCCCCCTCAGGTCCTCTTTGG - Intergenic
916739541 1:167636241-167636263 CACCTCTCTTAGGGACTCATTGG - Intronic
917660227 1:177170836-177170858 CACTCCCCACAGGTGCCCATTGG - Intergenic
918393511 1:184090916-184090938 CAGCTCCCTCAGGGACATATTGG + Intergenic
919972710 1:202591357-202591379 TACTGCCCTCAGGTGCCCATGGG + Exonic
920455843 1:206100495-206100517 CAGCACCCTCAGGTCCCCACAGG - Intronic
920684228 1:208096809-208096831 CACCTCTGTCAGGTTCCCAAAGG + Exonic
923273867 1:232380061-232380083 CACCTGCCTCAGGCCCCCACTGG - Intergenic
923444634 1:234057949-234057971 CACCCGCCTCAGCTACCCAAAGG + Intronic
1068205907 10:53852942-53852964 CACATAACTCAGGTAGCCATCGG - Intronic
1068923529 10:62511150-62511172 CACCAGCCTCAGGTGCCCAAAGG - Intronic
1070391020 10:75970622-75970644 CTTCTCTCTCAGGTACCCCTGGG + Intronic
1070724446 10:78778679-78778701 CACCCCACTCAGGTAGCCAGAGG - Intergenic
1071086339 10:81872671-81872693 CACCGTACTCAGCTACCCATTGG - Intergenic
1072103092 10:92247755-92247777 CACCTGCCTCAGCTTCCCAAAGG + Intronic
1073043336 10:100621849-100621871 CGCCTCCCCCAGCTCCCCATCGG - Intergenic
1074110508 10:110419436-110419458 CACCTCCTTCAGGTCCCACTGGG - Intergenic
1074460177 10:113629585-113629607 CACCTCGCTCTGGAGCCCATAGG + Exonic
1074941075 10:118236407-118236429 CACCTCCCTCAGGTGCTCCTTGG + Intergenic
1077182211 11:1221896-1221918 CACCACCCTAGGGTCCCCATGGG + Intergenic
1077592750 11:3505287-3505309 CACCTCCCAGAGGTCCCCAGTGG - Intergenic
1082961999 11:58927470-58927492 TCCCTCCCGCAGGCACCCATTGG + Intronic
1083298431 11:61727659-61727681 CCCCTCCCCCAGCTACCCACAGG - Intronic
1084248580 11:67878007-67878029 CACCTCCCAGAGGTCCCCAGTGG - Intergenic
1084691509 11:70729919-70729941 CACCTGGCTCAGGCACCTATCGG - Intronic
1084824245 11:71717469-71717491 CACCTCCCAGAGGTCCCCAGTGG + Intergenic
1086832502 11:91583199-91583221 CACCTGCCTCAGGCTCCCAAGGG + Intergenic
1087196071 11:95305422-95305444 CACCTCCTTCACATAGCCATGGG - Intergenic
1091036875 11:132242559-132242581 CCCCTCCCTCAGGTGCCCTTAGG + Intronic
1091369770 11:135048194-135048216 CACCTGCCTCAGCTTCCCAAAGG + Intergenic
1091994418 12:4982053-4982075 CAGCTCCCTCAGGTGGGCATGGG - Intergenic
1092418862 12:8313408-8313430 CACCTCCCAGAGGTCCCCAGTGG - Intergenic
1104218240 12:126755914-126755936 TACCTCCCTGCGGTAGCCATTGG + Intergenic
1104635271 12:130434616-130434638 CATCTCTCTCAGGGACCCAAGGG + Intronic
1108496788 13:51033510-51033532 CACCTCAGTCAGTCACCCATGGG + Intergenic
1111342259 13:86902021-86902043 CAGCTCCTTCTGGTACCCTTGGG + Intergenic
1112364092 13:98742144-98742166 CACCTCCCTCAGGACCCCCGAGG + Intronic
1113421621 13:110175500-110175522 CACATCCCTCATGTATCAATCGG + Intronic
1117000489 14:51366263-51366285 CACCTGCCTCAGGTTCCCCAGGG - Intergenic
1121873567 14:97430969-97430991 CACCTCCCTTAGGTACCACATGG - Intergenic
1127107525 15:55632654-55632676 CACCTCCCCCAGATATCCACAGG + Intronic
1129781647 15:78276359-78276381 CATCTCCCTCTGGCTCCCATGGG - Intronic
1131994420 15:98120339-98120361 CACATCCCTGAGGGACCCAGTGG + Intergenic
1132501672 16:287159-287181 CAGCTCCCTCTGGTACCCAAGGG - Exonic
1132763659 16:1523791-1523813 CCCCTCCCCCAGGTCCCCACCGG + Intronic
1132765503 16:1532339-1532361 CACGTCCCTCAGGAAGCCAGTGG + Intronic
1133358312 16:5153373-5153395 CACCTCCCCGAGGTCCCCAGTGG - Intergenic
1133536987 16:6711827-6711849 AACCTTCCCCAGGTACCCCTAGG + Intronic
1133778570 16:8918563-8918585 CACCTGCCTCAGCTTCCCAAGGG - Intronic
1134009872 16:10843915-10843937 CACCACCCACAGGCTCCCATTGG + Intergenic
1136008558 16:27347670-27347692 CACCTTCCTCACATTCCCATTGG + Intronic
1136593086 16:31229479-31229501 CACCTCACTCAGTCAGCCATGGG - Intergenic
1137396133 16:48117258-48117280 CACCTCAGTCAGGTCTCCATAGG + Exonic
1137575512 16:49597242-49597264 CTCCTCCCCCAGGTTCCCACTGG - Intronic
1137588924 16:49681685-49681707 CCACTCCCCCAGGTGCCCATGGG + Intronic
1137677130 16:50309257-50309279 CACCTCCCTCAGGGTCACCTGGG + Intronic
1142440289 16:90093900-90093922 CACCTCCCTCAGCCTCCGATTGG - Intergenic
1148220539 17:45858696-45858718 CACCTGAGTCAGGGACCCATGGG - Intergenic
1151708567 17:75785872-75785894 CACATCACTCAGGAGCCCATGGG - Intronic
1152103666 17:78316728-78316750 CACCACCCTCTGGGACCCCTGGG + Intergenic
1152226130 17:79093711-79093733 CACCTGCCTCCTGTACCCACTGG - Intronic
1152361455 17:79835009-79835031 CACCGCCCCCAGGTAGCCTTTGG + Exonic
1152957264 18:49658-49680 CACCTCCCTCAGCCTCCGATTGG + Exonic
1153030452 18:708846-708868 CAACTCCTTCAGGAACCCAATGG - Intronic
1153286289 18:3457751-3457773 CACCTCTCTCATGTACCCAGAGG + Exonic
1154331401 18:13432041-13432063 CTCCTCCCTCAGGTTCCCAGAGG + Intronic
1160272611 18:77401420-77401442 CACCTGCCTCAGCTTCCCAAAGG - Intergenic
1160317371 18:77860039-77860061 CACCTGCATCAGGCACCCTTAGG - Intergenic
1161295578 19:3518577-3518599 CACCTCGCAGAGGGACCCATGGG - Intronic
1162380990 19:10331881-10331903 CTCCCCAGTCAGGTACCCATGGG - Intronic
1162437320 19:10669240-10669262 CACCTCGCTCAAGCACCCTTAGG + Intronic
1163289801 19:16371870-16371892 CACCTCCCCCAGGTAAACAATGG - Intronic
1163511713 19:17739470-17739492 CCCCTCCCCCAGGGCCCCATGGG - Intergenic
1164438232 19:28250989-28251011 CACCTCCCAGAGGTCCCCAGTGG - Intergenic
1165112408 19:33510037-33510059 CACCACCCTCAGGCACGCACAGG + Intronic
1165434148 19:35787518-35787540 CCCCTCCTTGAGGTCCCCATGGG - Exonic
1166908901 19:46136912-46136934 CACCTCTCTCATGTGCCCAGAGG - Intergenic
1167936611 19:52913879-52913901 CACCTGCCTCAGCTTCCCAAAGG - Intergenic
1168116247 19:54222669-54222691 CTCCTCCCCCAGCTGCCCATGGG + Intronic
1168181109 19:54663623-54663645 CTCCTCCCCCAGCTGCCCATGGG - Intronic
1168452940 19:56479954-56479976 CCCCTGCCCCAGGAACCCATGGG + Intergenic
925293671 2:2764243-2764265 CAGCACACTCAGGGACCCATGGG + Intergenic
925894555 2:8461321-8461343 CACTTCCCTCAGGGAGACATGGG + Intergenic
926689766 2:15725253-15725275 CAGCTCCCTCATGCACACATGGG + Intronic
932571399 2:72940325-72940347 CCCTTCCCTCAGTTCCCCATGGG + Intergenic
932728248 2:74198541-74198563 CGCCTCCCTCCGCCACCCATTGG - Exonic
938869746 2:135462835-135462857 CACCTGCCTCAGCTTCCCAAAGG + Intronic
941770672 2:169342082-169342104 CATCTCCCTCAGGGAACCTTTGG - Intronic
942098525 2:172556073-172556095 CACGTCCCTCACGTACCACTCGG + Exonic
947745441 2:232504861-232504883 CACCTCCCTCAGGTCCCATCAGG - Intergenic
948260432 2:236600441-236600463 CACCTCCTTCAGGTAGCCCTCGG - Intergenic
1168827678 20:824755-824777 CACCTCCATCTGGTACCTCTAGG + Intergenic
1168968999 20:1918016-1918038 CTCATCCCTCATGTACCCAATGG - Intronic
1169701580 20:8453237-8453259 CACCTTCCACTGGAACCCATGGG - Intronic
1173291703 20:41720579-41720601 CACCTCCCTCAGCTTCCCAAAGG - Intergenic
1176265367 20:64206450-64206472 CCCCTCCCTCCGGGACCCAGGGG - Intronic
1179895882 21:44363014-44363036 CACCTGCCTCAGCTTCCCAAAGG + Intronic
1181367280 22:22387719-22387741 CACTTCCCTCATGGGCCCATTGG + Intergenic
1184103435 22:42353783-42353805 CACCTCGCCCAGCCACCCATGGG + Intergenic
1184996525 22:48211095-48211117 CACCTCCCACATGACCCCATTGG - Intergenic
1185033927 22:48460924-48460946 CACCTGCCCCAGGAACCCAAGGG + Intergenic
950408700 3:12820483-12820505 CTTCTCCCTCAGTTGCCCATGGG - Intronic
951632651 3:24738340-24738362 CACCTTCCTCAGGCAACAATGGG - Intergenic
952887972 3:38023109-38023131 CACCTCCCTCAGCTTCCCACTGG - Intronic
953837946 3:46363492-46363514 CACCTGCCTCAGCTTCCCAAAGG + Intergenic
956821405 3:72957502-72957524 CGCCTCCATCAGATACCCAGGGG - Intronic
957062829 3:75495961-75495983 CACCTCCCAGAGGTCCCCAGTGG - Intergenic
957533617 3:81472692-81472714 CACCTCCCTCACTGACACATGGG - Intergenic
960342866 3:116496944-116496966 CACCTCCTACAGGTACCTTTGGG + Intronic
960590710 3:119362830-119362852 CATCTACCTCAAGTGCCCATTGG + Intronic
961682627 3:128609035-128609057 CACCTCCCTCAGCCTCCCAAAGG + Intergenic
961896544 3:130172630-130172652 CACCTCCCAGAGGTCCCCAGTGG - Intergenic
962198938 3:133385569-133385591 CCCCTCCCACTGGCACCCATGGG + Intronic
962740814 3:138361555-138361577 CACCTCCCTCACCTGCCCAAGGG - Intronic
962971994 3:140409523-140409545 CCCCACCCTCACCTACCCATAGG + Intronic
967489963 3:190079094-190079116 CACCTGCCTCAGCTTCCCAAAGG - Intronic
968548432 4:1210351-1210373 CACCTCCCTCAGTGGCCCAGGGG + Intergenic
969806252 4:9611324-9611346 CACCTCCCAGAGGTCCCCAGTGG + Intergenic
969919831 4:10527289-10527311 CTCCTCCATCAGGGACCCATGGG + Intronic
972591854 4:40495355-40495377 CACCTGCCTCAGGCTCCCAAGGG - Intronic
975721164 4:77249958-77249980 CAACTCCCTCAGTTTCCCCTAGG + Intronic
979300874 4:119085816-119085838 CACCTGCCTCAGGCTCCCAAAGG - Intergenic
979936436 4:126703079-126703101 GAAATCCCTCAGGTAACCATAGG + Intergenic
980336953 4:131487988-131488010 CACCTGCCTCAGCCACCCAAAGG - Intergenic
980535984 4:134124365-134124387 CACCACCCTCACTTACCAATTGG + Intergenic
984428777 4:179622143-179622165 TACATCCCTCAGGCACCTATGGG + Intergenic
985626482 5:991586-991608 CACCTCCCTGAGCTCACCATGGG - Intergenic
990974646 5:61548770-61548792 CACTTCCCTCAGGCATCCGTGGG - Intergenic
992397421 5:76380691-76380713 CTCCTCACTCAGGAATCCATGGG + Intergenic
997527430 5:134562352-134562374 CACCCACCTCAGGAATCCATAGG - Exonic
1001604249 5:172948610-172948632 CTCTTCACTGAGGTACCCATGGG - Intronic
1001794986 5:174494465-174494487 CACCTCCCTCAGCAACTGATAGG + Intergenic
1003310857 6:4968791-4968813 CACCTGCCTCAGCCTCCCATAGG - Intergenic
1005634080 6:27736746-27736768 CACCAGCCTCAGGTCCACATAGG + Intergenic
1008693984 6:54012656-54012678 CACATGCTTCAGGTACCCAAGGG - Intronic
1009888803 6:69656092-69656114 CACCTCCTACAGGTACCTTTGGG + Intergenic
1015276751 6:131390232-131390254 CACCTGCCTCAGGCTCCCAAGGG - Intergenic
1017503161 6:155043946-155043968 CATGGCCCTCAGGTACCCAGTGG - Intronic
1017773433 6:157661169-157661191 CACCACCCCCAGGTATCCATGGG - Intronic
1017866569 6:158449165-158449187 CCCCTCCCCAAGGTACTCATTGG + Exonic
1018103879 6:160465122-160465144 CACCACCCCCAGGTACCCCAAGG - Intergenic
1019748144 7:2712216-2712238 CACCGTCCTCAGTTACCCAGGGG - Intronic
1019885798 7:3903860-3903882 CAGCTCTCTCAGGAACCAATAGG - Intronic
1020327232 7:6984240-6984262 CACCTCCCAGAGGTCCCCAGTGG - Intergenic
1023923023 7:44644825-44644847 CACCTCCCTCAAGGCCCCAAGGG - Intronic
1025853846 7:65262168-65262190 CACCCCTCTCAGGTCACCATTGG - Intergenic
1026382939 7:69817589-69817611 CCCCTCCCTCAGCAACCCACTGG - Intronic
1026441704 7:70450644-70450666 CACCTACATAAGGTACCCAGTGG - Intronic
1030018645 7:105250084-105250106 CACCTCCCTCGGACTCCCATAGG - Intronic
1035117893 7:156540118-156540140 CACTTCGCTCCGGGACCCATCGG + Intergenic
1036782168 8:11657294-11657316 CACCTACCTCAGCTACCAGTAGG + Intergenic
1037454629 8:19051191-19051213 CTCCTCCCTCTGGTCCCAATCGG + Intronic
1037552152 8:19985095-19985117 CACCTGCCTCAGCTTCCCAAAGG - Intergenic
1039864508 8:41489884-41489906 CACATCCCTCAGGTGACCAAGGG - Intergenic
1044716277 8:95102645-95102667 CACCTCCCTCAGGTACCCATGGG - Intronic
1045367900 8:101493476-101493498 CACCTTCCTCAGGTGCCCGGGGG + Intronic
1047996909 8:130345612-130345634 CACCTCCCTCAGGTACTAGCAGG + Intronic
1049064317 8:140301005-140301027 CACCTTCCCCATGGACCCATGGG + Intronic
1049094304 8:140539454-140539476 CTCCTCCCTCCCGTACCCCTAGG - Exonic
1049633293 8:143671415-143671437 CACCTGCCTCAGCCTCCCATGGG + Intergenic
1050514067 9:6424166-6424188 CAGCTCTCCCAGGTATCCATAGG - Intronic
1052843904 9:33317729-33317751 CACCTGCCTCAGCTTCCCAAAGG - Intronic
1053143600 9:35697397-35697419 CCCCACCCCCAGCTACCCATAGG - Exonic
1053305223 9:36980180-36980202 CACCTCCCTCAGGCAGCCACCGG - Intronic
1060907590 9:127321359-127321381 CACCTGCCTCAGGCTCCCAAAGG + Intronic
1062320588 9:135988842-135988864 CACCTCCCCCAGGGGCCCAGAGG - Intergenic
1062599514 9:137313605-137313627 CTCCTCCCTCTGGGCCCCATGGG + Intronic
1062740881 9:138174919-138174941 CACCTCCCTCAGCCTCCGATTGG - Intergenic
1186676295 X:11821058-11821080 TTCATCCCTCAGGTACCCTTGGG - Intergenic
1195880339 X:109586534-109586556 CACCTCCCTCCTGTTCTCATTGG + Intergenic
1200092819 X:153643804-153643826 CAGCTCCCTCAGGCAACAATTGG + Intronic