ID: 1044716277

View in Genome Browser
Species Human (GRCh38)
Location 8:95102645-95102667
Sequence CACCTCCCTCAGGTACCCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044716277_1044716281 -6 Left 1044716277 8:95102645-95102667 CCCATGGGTACCTGAGGGAGGTG No data
Right 1044716281 8:95102662-95102684 GAGGTGCCCTGGTAAGCTGCTGG No data
1044716277_1044716285 10 Left 1044716277 8:95102645-95102667 CCCATGGGTACCTGAGGGAGGTG No data
Right 1044716285 8:95102678-95102700 CTGCTGGTACTGAAGGAGCCAGG No data
1044716277_1044716284 3 Left 1044716277 8:95102645-95102667 CCCATGGGTACCTGAGGGAGGTG No data
Right 1044716284 8:95102671-95102693 TGGTAAGCTGCTGGTACTGAAGG No data
1044716277_1044716286 19 Left 1044716277 8:95102645-95102667 CCCATGGGTACCTGAGGGAGGTG No data
Right 1044716286 8:95102687-95102709 CTGAAGGAGCCAGGTGCTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044716277 Original CRISPR CACCTCCCTCAGGTACCCAT GGG (reversed) Intronic