ID: 1044716278

View in Genome Browser
Species Human (GRCh38)
Location 8:95102646-95102668
Sequence GCACCTCCCTCAGGTACCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 218}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044716278_1044716285 9 Left 1044716278 8:95102646-95102668 CCATGGGTACCTGAGGGAGGTGC 0: 1
1: 0
2: 1
3: 17
4: 218
Right 1044716285 8:95102678-95102700 CTGCTGGTACTGAAGGAGCCAGG No data
1044716278_1044716281 -7 Left 1044716278 8:95102646-95102668 CCATGGGTACCTGAGGGAGGTGC 0: 1
1: 0
2: 1
3: 17
4: 218
Right 1044716281 8:95102662-95102684 GAGGTGCCCTGGTAAGCTGCTGG No data
1044716278_1044716286 18 Left 1044716278 8:95102646-95102668 CCATGGGTACCTGAGGGAGGTGC 0: 1
1: 0
2: 1
3: 17
4: 218
Right 1044716286 8:95102687-95102709 CTGAAGGAGCCAGGTGCTAGAGG No data
1044716278_1044716284 2 Left 1044716278 8:95102646-95102668 CCATGGGTACCTGAGGGAGGTGC 0: 1
1: 0
2: 1
3: 17
4: 218
Right 1044716284 8:95102671-95102693 TGGTAAGCTGCTGGTACTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044716278 Original CRISPR GCACCTCCCTCAGGTACCCA TGG (reversed) Intronic
900612234 1:3549042-3549064 GCGGCGCCCGCAGGTACCCAAGG - Intronic
900673078 1:3868035-3868057 TCACCTCCCTCAGGTAACTCCGG - Exonic
900828190 1:4943429-4943451 GCTCCTCCCTCAGTTTCTCAGGG - Intergenic
900979351 1:6037493-6037515 CCACGTCCCTCAGCTACTCAGGG + Intronic
904335427 1:29794150-29794172 ACCCCTCCCTCAGGCCCCCAAGG + Intergenic
905074785 1:35260862-35260884 TCACCTGCCTCAGCTTCCCAAGG - Intergenic
906157598 1:43622964-43622986 GCAGCTCCCTCGGGAACCCCAGG - Exonic
906275234 1:44510340-44510362 GCTGCTCCCTCAGCTACCCCAGG + Intronic
906512818 1:46420795-46420817 TCACCTTCCTGAGGTGCCCAGGG - Intergenic
907550990 1:55304587-55304609 GCACCTCCCCCAGCCACTCAGGG - Intergenic
907618038 1:55944908-55944930 GCACCTACCTCATGTGCCCATGG + Intergenic
909956163 1:81781694-81781716 GCACCTGCTTCTGATACCCATGG - Intronic
911341690 1:96646617-96646639 CCACCTCCCTCAGCCTCCCATGG - Intergenic
912257894 1:108079980-108080002 GCACCTACCTTTGGCACCCAGGG - Intergenic
919972709 1:202591356-202591378 GTACTGCCCTCAGGTGCCCATGG + Exonic
920374586 1:205501057-205501079 GCTCAGCCCTCAGGCACCCAGGG + Intergenic
923820160 1:237429455-237429477 GCATCTGCCTCAGGCTCCCATGG - Intronic
1067044038 10:42974592-42974614 GCCCCTTCCCCAGGGACCCAGGG - Intergenic
1068737011 10:60425193-60425215 GCAGCTCCCTCACTTGCCCACGG - Intronic
1068840982 10:61613836-61613858 GCACCTCCCTCAGACAGCTATGG + Intergenic
1070634123 10:78110221-78110243 TCACCTACCTCAGCTAACCAGGG - Intergenic
1070650172 10:78229530-78229552 GCACCTGCCTGAGGGGCCCAGGG - Intergenic
1073480388 10:103783003-103783025 TCCCTTCCCTCAGGTCCCCAAGG - Intronic
1073622452 10:105063274-105063296 GCACATCTCTCAGGTTGCCAAGG - Intronic
1076145195 10:128113228-128113250 GCACCACGGTCAGGGACCCAGGG + Intronic
1076888457 10:133273070-133273092 GACCCTCCCTCAGGGACCCGGGG + Intronic
1077217910 11:1402727-1402749 GCCCCTCACTCAGGGACACAGGG + Intronic
1077489597 11:2854646-2854668 GCCCCTCTCTCAGGTGCCCTGGG + Intergenic
1078761783 11:14257668-14257690 GCAGCTCCCATAGGTTCCCAGGG + Intronic
1078779299 11:14421919-14421941 CCACCTGCCTCAGCTTCCCAAGG - Intergenic
1084213479 11:67634474-67634496 GCACCTTGCTAAGGAACCCAAGG + Intronic
1085318150 11:75558388-75558410 CCCCCTCCCTCAGGGAGCCAGGG - Intergenic
1086832501 11:91583198-91583220 CCACCTGCCTCAGGCTCCCAAGG + Intergenic
1087623413 11:100567994-100568016 GCACCTTCCCCAGGTTCTCAGGG + Intergenic
1089884794 11:121809677-121809699 TCCCATCCTTCAGGTACCCATGG - Intergenic
1090874054 11:130773342-130773364 GTACCTCCCTCCAGGACCCAAGG + Intergenic
1091034302 11:132219295-132219317 GCACCTCTTACAGGTACTCAAGG + Intronic
1091994419 12:4982054-4982076 GCAGCTCCCTCAGGTGGGCATGG - Intergenic
1092104974 12:5914852-5914874 ACCCCTCCCTCAGGTGCCCCTGG + Intronic
1093788430 12:23218622-23218644 CCACATCCCTGAGGTAACCATGG - Intergenic
1096239443 12:49951779-49951801 GCACCACCCTCAGCTCCCAAAGG - Intronic
1096547713 12:52352354-52352376 CCACCTCCCTCAGTCTCCCAAGG + Intergenic
1096667038 12:53172821-53172843 GTAAATCCCTGAGGTACCCAGGG + Intronic
1096829653 12:54304410-54304432 CCAGCTCCCTCTGGGACCCATGG - Intronic
1096899378 12:54859177-54859199 ACACCTCTCTCAGTTCCCCATGG + Intergenic
1099528097 12:83740882-83740904 GGACCTCCCTCTGCTAGCCAAGG + Intergenic
1101390174 12:104293136-104293158 GCATCTCCCTCAGGATTCCAGGG + Intronic
1101709955 12:107256046-107256068 CCACCTCCCTAAAGTATCCATGG - Intergenic
1104599486 12:130142820-130142842 GCAGCACCCTCAGCTACCCTGGG + Intergenic
1104635270 12:130434615-130434637 CCATCTCTCTCAGGGACCCAAGG + Intronic
1104679976 12:130743341-130743363 GCCCCTCCAGCAGGTGCCCAGGG - Intergenic
1104848343 12:131858339-131858361 GCACATCCCTGAAGCACCCAGGG - Intergenic
1104877352 12:132044904-132044926 GCTCCTTCCTCACGTACACAGGG - Exonic
1104961268 12:132489730-132489752 GCGCCGCCCGCAGGTGCCCACGG + Exonic
1105504220 13:20996622-20996644 CCACCTGCCTCAGCTTCCCAAGG + Intronic
1107359132 13:39601067-39601089 GCACCTCCGGAAGGTACCGAAGG + Exonic
1111342258 13:86902020-86902042 GCAGCTCCTTCTGGTACCCTTGG + Intergenic
1112818725 13:103305655-103305677 CCTCCTCCCTCAGCTACCCAAGG - Intergenic
1113816634 13:113176104-113176126 GCTCCTTCCTCAGGTTCCCCTGG - Intergenic
1114656387 14:24318420-24318442 GGACCTCCTTCAGCTACCCTAGG - Exonic
1117000490 14:51366264-51366286 CCACCTGCCTCAGGTTCCCCAGG - Intergenic
1117369036 14:55059044-55059066 CAATCTCCCTCAGGTACCGAGGG + Intronic
1117991994 14:61442827-61442849 GCTCCTACCTCAGCAACCCAAGG - Intronic
1122985260 14:105208881-105208903 GCACCTCCCTCGGGGCCCCTGGG + Intergenic
1123043860 14:105501957-105501979 GCACCTCCCCCTGGAGCCCAGGG + Intergenic
1123072463 14:105648422-105648444 GCTCGGCCCTCAGGTCCCCAGGG + Intergenic
1123129113 14:105971796-105971818 GCACCTCCTCCAGGTAGCCGAGG + Intergenic
1123180878 14:106469057-106469079 GCACCTGACCCAGGCACCCAGGG + Intergenic
1202946018 14_KI270726v1_random:27601-27623 GCACCTGACCCAGGCACCCAGGG - Intergenic
1123409633 15:20047964-20047986 GCACCTCCTCCAGGTAGCCGAGG + Intergenic
1123518964 15:21054672-21054694 GCACCTCCTCCAGGTAGCCGAGG + Intergenic
1124057642 15:26257009-26257031 GCATCTCGCTCAGTTGCCCAGGG + Intergenic
1125757124 15:42071595-42071617 GCCCCACCCTCAGGTACTGATGG + Intronic
1127383025 15:58445615-58445637 GAGTCTCCCTCAGGGACCCATGG - Intronic
1127619679 15:60721404-60721426 GCACCTCCCTGAGGAGACCAAGG + Intronic
1129136300 15:73555320-73555342 GCAGCAACCTCAGGTACCCAAGG + Intronic
1129781648 15:78276360-78276382 GCATCTCCCTCTGGCTCCCATGG - Intronic
1129960907 15:79682846-79682868 CCACCCCCATCAGGTACCAAGGG + Intergenic
1131048340 15:89330267-89330289 TCACCTCCCTCAGGTATTCCTGG - Exonic
1131368463 15:91860115-91860137 TAACCTCCTTCAAGTACCCATGG - Intronic
1131612391 15:93978784-93978806 GTCCCTCCCTCAGCCACCCAAGG + Intergenic
1132387090 15:101408366-101408388 GCAGCCCTCTCAGGAACCCAGGG + Intronic
1132501673 16:287160-287182 ACAGCTCCCTCTGGTACCCAAGG - Exonic
1132837371 16:1960809-1960831 GCACCTCCCCCAGCTGCACAGGG - Intronic
1133778571 16:8918564-8918586 CCACCTGCCTCAGCTTCCCAAGG - Intronic
1135884793 16:26296001-26296023 TCACGTCCCTCTGGTTCCCAGGG - Intergenic
1136277513 16:29187620-29187642 GCGCCTGCCTCAGGCACCCGGGG - Intergenic
1136612139 16:31372649-31372671 GCATCTCCTTCAGCTTCCCAGGG + Exonic
1137588922 16:49681684-49681706 GCCACTCCCCCAGGTGCCCATGG + Intronic
1137701932 16:50503678-50503700 GCACATCCCACAGGGCCCCAGGG + Intergenic
1138381670 16:56607228-56607250 GCACCTTCCACAGGCAGCCACGG + Intergenic
1139424829 16:66873197-66873219 GCACCGGCCTGAGCTACCCAGGG - Intronic
1139586685 16:67908510-67908532 CCACCTGCCTCAGCTTCCCAAGG + Intronic
1139988719 16:70921550-70921572 GCACCTGCCTCAGGTGCCCTGGG + Intronic
1141636737 16:85317906-85317928 CCACCTCCCCCAGGAACCCCGGG - Intergenic
1142081891 16:88153662-88153684 GCGCCTGCCTCAGGCACCCGGGG - Intergenic
1144439996 17:15272699-15272721 GCCCCTCCCTCATGTACAGATGG - Intergenic
1144497640 17:15758516-15758538 GAGCCTCCCTCAGGAACCCAGGG - Intergenic
1144558576 17:16303035-16303057 GCTCCTCCCTCAGATACTCAGGG - Intronic
1144629436 17:16862999-16863021 GAGCCTCCCTCAGGAACCCAGGG - Intergenic
1144651992 17:17013117-17013139 GAGCGTCCCTCAGGAACCCAGGG + Intergenic
1145161009 17:20573565-20573587 GAGCCTCCCTCAGGAACCCAGGG - Intergenic
1146638910 17:34525731-34525753 GCTCCTCTCTGAGGGACCCAGGG - Intergenic
1147379763 17:40046997-40047019 CCTCCTACCTCAGGTTCCCAAGG - Intronic
1148220540 17:45858697-45858719 GCACCTGAGTCAGGGACCCATGG - Intergenic
1150281071 17:63929950-63929972 GCAGCTCCCTCAGGTCCCAGTGG + Intronic
1151674383 17:75590073-75590095 ACAGCTCCCTCAGGGACCCACGG - Intergenic
1151708568 17:75785873-75785895 GCACATCACTCAGGAGCCCATGG - Intronic
1153706364 18:7749535-7749557 GCACTTCCCACAGGGCCCCAAGG - Intronic
1153820083 18:8825229-8825251 GCACCTCCCCCAGGCACTCCCGG + Exonic
1154041664 18:10861772-10861794 CCACCTGCCTCAGCTTCCCAAGG - Intronic
1155075036 18:22347128-22347150 GCTCCTCCCCCAGCTTCCCAGGG - Intergenic
1156879444 18:42059450-42059472 CCACCTCCCTGAGATATCCATGG - Intronic
1157469772 18:47980037-47980059 ACACCTCCCTCAGGGATGCAGGG + Intergenic
1158352166 18:56573898-56573920 GCCCCTCCCTGAGTTAACCATGG - Intergenic
1160265865 18:77340436-77340458 GCACCTCACTCAGGACTCCAGGG + Intergenic
1160265874 18:77340491-77340513 GCACCTCACTCAGGACTCCAGGG + Intergenic
1161295579 19:3518578-3518600 GCACCTCGCAGAGGGACCCATGG - Intronic
1162380991 19:10331882-10331904 GCTCCCCAGTCAGGTACCCATGG - Intronic
1164821425 19:31254279-31254301 GCACAGCACTCTGGTACCCAGGG - Intergenic
1165504695 19:36218181-36218203 GTACCTACCTGAGGTCCCCAAGG - Intronic
1166109350 19:40613088-40613110 GCCCCTCCCTGTGGTCCCCACGG + Exonic
1166123004 19:40696724-40696746 ACACCTCCCCCAGGTCCCCAGGG + Intronic
1166336974 19:42114170-42114192 CCACCTCCCCCAGCTCCCCAGGG - Intronic
1166435623 19:42764636-42764658 ACACCTCCTTCAGATACCCTGGG + Intronic
1166719782 19:44990316-44990338 GCAGCTCCCTCAGGCCCCCTTGG - Intronic
925894554 2:8461320-8461342 GCACTTCCCTCAGGGAGACATGG + Intergenic
926178403 2:10617500-10617522 GTCCCTCCCCCAGGTCCCCAGGG - Intronic
929573841 2:43039953-43039975 CCACCGCCCACAGGCACCCAGGG - Intergenic
936889244 2:117349902-117349924 GCACATCCCAGAGGCACCCATGG - Intergenic
939759457 2:146156112-146156134 GCACCTGACTCATGTACCAAGGG - Intergenic
942115732 2:172727210-172727232 GCAGCTCCCTGAGGTGGCCAGGG + Intergenic
947314055 2:228835894-228835916 CCACTTCCCTCAGGTCCACATGG - Intergenic
947565300 2:231189707-231189729 GCACCTCCCCCAGGATCCCGGGG + Intergenic
949079391 2:242084751-242084773 GCACCTCCTCCTTGTACCCATGG + Intergenic
1170228074 20:14013915-14013937 CCACCTGCCTCAGGCTCCCAAGG + Intronic
1171086927 20:22246140-22246162 CCACCTCCCTCAGGTCCCTCTGG + Intergenic
1171268519 20:23794093-23794115 GCACCTCCCTCTGCAACACAGGG - Intergenic
1172195641 20:33089734-33089756 GCTCCTCCCTCTGGTACTCGGGG - Intronic
1172926827 20:38545190-38545212 GCACTTCCTTCAGGTCCACAGGG + Intronic
1173941652 20:46915839-46915861 GCCCCTCCCTCTAGTACCCCCGG + Intronic
1175843792 20:62048455-62048477 GCCCCTCCCTCCTGTCCCCAGGG + Intronic
1176265369 20:64206451-64206473 ACCCCTCCCTCCGGGACCCAGGG - Intronic
1178959395 21:37050827-37050849 CCACCTACCTCAGCCACCCAAGG - Intergenic
1181160707 22:20957967-20957989 GCGCCTCCCTCAGGGACTCTGGG - Intergenic
1183070778 22:35394593-35394615 CCACCTGCCTCAGCTTCCCAAGG + Intergenic
1183235573 22:36614416-36614438 GCAGCTCCTTCTGGTTCCCATGG + Intronic
1183361400 22:37385007-37385029 GCTCCTCCCCCAGGGTCCCAAGG + Intronic
1184149428 22:42629674-42629696 CCAGCACCCTCAGGTACCCCTGG - Intronic
1184616284 22:45640553-45640575 GCCCTTCCCTCTGGGACCCAGGG - Intergenic
1184799395 22:46750738-46750760 ACTCCTCACTCTGGTACCCAAGG - Intergenic
1185033926 22:48460923-48460945 TCACCTGCCCCAGGAACCCAAGG + Intergenic
949408862 3:3742360-3742382 GCCTTTCTCTCAGGTACCCAGGG - Intronic
950110213 3:10413898-10413920 GCCCCTCCCTCAGAGGCCCACGG - Intronic
950431931 3:12955758-12955780 GCCCATCCCTCAGGGACCCTCGG + Intronic
950432431 3:12958587-12958609 TCACCTCCCTCTAGCACCCATGG - Intronic
950475173 3:13210397-13210419 GCACCTCCCTGGGCTGCCCAGGG + Intergenic
953261919 3:41347962-41347984 CCACCTGCCTCAGGCTCCCAAGG - Intronic
954199439 3:49015402-49015424 GCACCGACATCAGGAACCCACGG - Exonic
956821406 3:72957503-72957525 CCGCCTCCATCAGATACCCAGGG - Intronic
959493715 3:107023657-107023679 GCACCTGCCTCAGCTTCCCAAGG - Intergenic
962740815 3:138361556-138361578 GCACCTCCCTCACCTGCCCAAGG - Intronic
967948829 3:194824765-194824787 GCACCTCACTCACTGACCCAAGG + Intergenic
968548431 4:1210350-1210372 CCACCTCCCTCAGTGGCCCAGGG + Intergenic
968575907 4:1366033-1366055 GCACCTCCCACAGGGACCTGGGG + Intronic
968885727 4:3330773-3330795 CCACCCTCCTCAGGAACCCAGGG + Intronic
969258821 4:6021192-6021214 GAACCTCCCTGAGGATCCCAAGG - Intergenic
969567245 4:7985752-7985774 GCACCTGTCTCAGGTGCCCGTGG + Intronic
969919830 4:10527288-10527310 ACTCCTCCATCAGGGACCCATGG + Intronic
970486672 4:16531614-16531636 GCAACTCCCTCAGGTTCACATGG + Intronic
971261120 4:25057678-25057700 GCACCTCCCTAGGGTGCTCATGG + Intergenic
972591855 4:40495356-40495378 CCACCTGCCTCAGGCTCCCAAGG - Intronic
972600204 4:40565414-40565436 GCCCCTTCCCCAGGAACCCAAGG - Intronic
973980368 4:56303730-56303752 GCTCAGTCCTCAGGTACCCAAGG - Intronic
975723373 4:77269356-77269378 GCACTCCCCTGAGGGACCCAAGG - Intronic
977897887 4:102384547-102384569 GGACCTCCCTCCCCTACCCAAGG - Intronic
979126469 4:116979397-116979419 TCACATCACTCAGGTAGCCAGGG - Intergenic
985450024 4:190056803-190056825 GCAGCTCCCTCAGGCTCCCAGGG + Intergenic
992256610 5:74927542-74927564 GCACCTCACTTGGTTACCCAAGG - Intergenic
995420022 5:111953934-111953956 GATACTCCCTCAGGTACACATGG - Intronic
995538853 5:113164858-113164880 GAAACTCCCTCTGGTACCAATGG - Intronic
998387887 5:141768549-141768571 GCACCACCCTGAAGTTCCCATGG + Intergenic
999329470 5:150662740-150662762 GCACCTCCCTCTCGTTCCCTGGG + Intronic
999718373 5:154380236-154380258 GCAGCTGCCTCAGGGCCCCATGG + Intronic
1005403426 6:25459493-25459515 CCACCTGCCTCAGCTTCCCAAGG + Intronic
1006037221 6:31223149-31223171 GCACCACCCCCAGGAACCCCAGG + Intergenic
1006188317 6:32192574-32192596 CCACTCCCCTCAGGAACCCAAGG - Exonic
1007110469 6:39310681-39310703 GCATCTCACCCAGGTCCCCAGGG - Intronic
1007615344 6:43176481-43176503 CCACCTCCACCAAGTACCCATGG - Intronic
1008693985 6:54012657-54012679 GCACATGCTTCAGGTACCCAAGG - Intronic
1014523968 6:122478987-122479009 GGAACTCCCTCTGGTAGCCAAGG - Intronic
1015276752 6:131390233-131390255 CCACCTGCCTCAGGCTCCCAAGG - Intergenic
1016351922 6:143177814-143177836 GTGCATCCCTCAGGGACCCAAGG - Intronic
1017773434 6:157661170-157661192 CCACCACCCCCAGGTATCCATGG - Intronic
1017967290 6:159277368-159277390 CCCCCTCCCTTAGGTATCCAAGG - Intergenic
1019739127 7:2664108-2664130 GCTCCTCCCTCTTGTCCCCAGGG - Exonic
1019748145 7:2712217-2712239 CCACCGTCCTCAGTTACCCAGGG - Intronic
1021927292 7:25545836-25545858 GCACAGCCCTCAGCTGCCCAAGG - Intergenic
1022364158 7:29694189-29694211 TCTCCTGCCTCAGGTTCCCAAGG - Intergenic
1022697205 7:32719552-32719574 TCTCCTGCCTCAGGTTCCCAAGG + Intergenic
1023081421 7:36530067-36530089 TCACATCCATCAGGTAACCAGGG + Intronic
1023923024 7:44644826-44644848 ACACCTCCCTCAAGGCCCCAAGG - Intronic
1024629826 7:51237996-51238018 GCATGCCCCTCAGGTACCAAAGG + Intronic
1026165245 7:67903657-67903679 CCACCTCCCTCAGCCTCCCAAGG - Intergenic
1026828244 7:73596871-73596893 GCACCCTCCTCCGGTCCCCAGGG - Exonic
1027452491 7:78348364-78348386 GTATCTCCCTTAGATACCCAGGG + Intronic
1031592337 7:123609153-123609175 GCATCTCCCTCAGAACCCCAGGG + Intronic
1033599829 7:142881161-142881183 GCACCTCCTTCAGGGACCCAAGG - Intronic
1035369275 7:158368709-158368731 GCAGGTCCCTCAGAGACCCAAGG + Intronic
1035537538 8:403839-403861 GCACCTCCTCCTTGTACCCATGG + Intergenic
1036694923 8:10968084-10968106 GCTGCTCCCCCTGGTACCCAGGG + Intronic
1038440621 8:27568878-27568900 GCCCTTCCCCCAGGAACCCATGG + Intergenic
1038730952 8:30127320-30127342 GCAGCTCTTTCAGGTCCCCAGGG - Intronic
1039864509 8:41489885-41489907 CCACATCCCTCAGGTGACCAAGG - Intergenic
1039919443 8:41882941-41882963 GCACCTGCCTCAGGTGAACAGGG - Intronic
1044716278 8:95102646-95102668 GCACCTCCCTCAGGTACCCATGG - Intronic
1045367899 8:101493475-101493497 CCACCTTCCTCAGGTGCCCGGGG + Intronic
1045507496 8:102788987-102789009 GCACCACCCAAAGGTACCCTGGG - Intergenic
1049210296 8:141383453-141383475 GCACCTCCCACATGCTCCCAGGG + Intergenic
1049237031 8:141517580-141517602 GCACCTCCCTCTGGATTCCAGGG + Intronic
1049664173 8:143835674-143835696 GCACCTTCCTCAAGTACCGTGGG - Exonic
1049955420 9:688649-688671 TCACCTCTCTCTGGAACCCAAGG - Intronic
1052443396 9:28527522-28527544 CCATCTTCATCAGGTACCCAGGG + Intronic
1053359859 9:37477116-37477138 GCAGCTCACTCAGGAACCCGCGG + Intergenic
1055592763 9:77834974-77834996 GCATCTCCCTCAGGTAAGGAGGG - Intronic
1058827372 9:108787215-108787237 GCAACTCCCTGATGTACTCACGG + Intergenic
1059711179 9:116868939-116868961 CCACCTGCCTCAGCTTCCCAGGG - Intronic
1060645892 9:125279325-125279347 CCACCTGCCTCAGCTTCCCAAGG - Intronic
1060993180 9:127860642-127860664 GGCCCTCCCTCAGATTCCCAGGG + Intergenic
1061133843 9:128722428-128722450 GCCCCAGCCTCAGGTAACCAGGG - Exonic
1061180009 9:129019595-129019617 GGTCCTCCCTCAGCTACCCAAGG - Intronic
1061722067 9:132557972-132557994 CCACCTCCCTCCCGTGCCCACGG + Intronic
1203787455 EBV:135928-135950 GCCCCTCCCTCGAGAACCCAAGG + Intergenic
1185838410 X:3367055-3367077 TCACCTGCCTCAGGTGCCCGGGG + Intergenic
1187631349 X:21176129-21176151 TCACCTCCCTCAGGTGCAGAGGG - Intergenic
1189292326 X:39895201-39895223 GCAATTCCCTCAGGTCCCCCTGG + Intergenic
1189388110 X:40554142-40554164 GCATCACTCCCAGGTACCCACGG + Intergenic