ID: 1044716280

View in Genome Browser
Species Human (GRCh38)
Location 8:95102655-95102677
Sequence CTTACCAGGGCACCTCCCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 182}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044716280_1044716285 0 Left 1044716280 8:95102655-95102677 CCTGAGGGAGGTGCCCTGGTAAG 0: 1
1: 0
2: 0
3: 21
4: 182
Right 1044716285 8:95102678-95102700 CTGCTGGTACTGAAGGAGCCAGG No data
1044716280_1044716284 -7 Left 1044716280 8:95102655-95102677 CCTGAGGGAGGTGCCCTGGTAAG 0: 1
1: 0
2: 0
3: 21
4: 182
Right 1044716284 8:95102671-95102693 TGGTAAGCTGCTGGTACTGAAGG No data
1044716280_1044716286 9 Left 1044716280 8:95102655-95102677 CCTGAGGGAGGTGCCCTGGTAAG 0: 1
1: 0
2: 0
3: 21
4: 182
Right 1044716286 8:95102687-95102709 CTGAAGGAGCCAGGTGCTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044716280 Original CRISPR CTTACCAGGGCACCTCCCTC AGG (reversed) Intronic
900316772 1:2060899-2060921 CTTTCCCGGGACCCTCCCTCTGG + Intronic
900347538 1:2216776-2216798 CTGAGCAGGGCACCTGCCTCTGG - Intergenic
900387550 1:2417441-2417463 CTCACCAGGCCCCCTCCCTCCGG - Intergenic
900411411 1:2514349-2514371 CTTACAAGGGCTGCTGCCTCAGG + Exonic
900458297 1:2787802-2787824 CTGGCCTGGGCAGCTCCCTCCGG + Intronic
900598862 1:3494556-3494578 CAGCCCAGGGCACCTCCCTGAGG + Intronic
900666091 1:3816506-3816528 CTCACCTGGGCACCTCCCTTCGG + Intronic
904348700 1:29891013-29891035 CTTACCCAGGAACCTCACTCTGG + Intergenic
905516908 1:38568795-38568817 CACACCAGGGCACTTCCCTCAGG + Intergenic
908480641 1:64535746-64535768 TTTAGTAGGCCACCTCCCTCAGG + Intronic
909568746 1:77084435-77084457 GCTAACAGGGCACCTTCCTCTGG - Intergenic
911417936 1:97599264-97599286 GTTGCCAAAGCACCTCCCTCTGG + Intronic
912958910 1:114177659-114177681 CTTACCCAGGCAGCTTCCTCTGG + Intergenic
916474440 1:165155236-165155258 CTCACCAGGTCTCTTCCCTCTGG + Intergenic
916585308 1:166144831-166144853 TTTACCATGGCACCTCACCCAGG + Intronic
919857117 1:201713525-201713547 CTTCCCACGGCACCTCTCTCTGG + Intronic
920071710 1:203307067-203307089 CTAACCAGGGCATCTGCCCCTGG + Intronic
922057846 1:222058441-222058463 CTTGCCAGGGCCCCTCCAGCAGG + Intergenic
922561526 1:226572980-226573002 CTTCCCATGTGACCTCCCTCTGG - Intronic
923548640 1:234943582-234943604 TTTACAAGGGCACCTCCCAAAGG + Intergenic
1065509632 10:26465853-26465875 ATTTCCAGGGCACCTGCATCTGG - Intronic
1070461828 10:76678015-76678037 CTTATCAGGGCATCTCCAGCAGG - Intergenic
1076164223 10:128268844-128268866 CTTTCCAGCGCACCTGGCTCTGG - Intergenic
1076315327 10:129535941-129535963 CTTACCAGGTCAGCTTCCTTCGG + Intronic
1080826466 11:35853048-35853070 CTTACCAGATCCTCTCCCTCAGG + Intergenic
1081859273 11:46323147-46323169 CTTAACAGGGTCCTTCCCTCTGG - Intergenic
1083311409 11:61785792-61785814 CTCTCCAGGGCACCTCTCACCGG + Exonic
1083486020 11:62983504-62983526 CTTACCAGCCCACTCCCCTCCGG - Intronic
1083825976 11:65204368-65204390 CTTCCCAGGGCAGCCCCTTCGGG + Intronic
1084333962 11:68446304-68446326 CTTCCCAGGACCCCTTCCTCTGG - Intronic
1095517285 12:43020771-43020793 CGAACCAGGGCAACTCCATCTGG - Intergenic
1097275175 12:57808225-57808247 CTTTCCTGGGCAGCTACCTCTGG + Exonic
1097803543 12:63940807-63940829 CTCACAAGGGCACCTGCCTCAGG + Intronic
1101278723 12:103228066-103228088 CTGATCAGGGGACCTCCCTTGGG - Intergenic
1102536008 12:113582034-113582056 CTTTGCAGGGCACCTCCATGTGG - Intergenic
1104874173 12:132021455-132021477 CTCACCAGTGCAGCTGCCTCCGG + Intronic
1106125474 13:26897202-26897224 ATTATCAGGGCTCCACCCTCAGG + Intergenic
1106304132 13:28495179-28495201 CCTACCCCGGCACCTCCTTCTGG + Intergenic
1111609352 13:90583336-90583358 CTTATGAGGGCCCCACCCTCAGG - Intergenic
1114628832 14:24146800-24146822 CTTACCCTAGCCCCTCCCTCGGG - Exonic
1117046302 14:51816689-51816711 CTGGCCAGGGCTCCACCCTCAGG - Intergenic
1117476278 14:56098282-56098304 CTGACCAGAGCACCTCCATGTGG + Intergenic
1121292784 14:92791244-92791266 CTTACCAAGTCAGCCCCCTCTGG + Intergenic
1122204406 14:100141455-100141477 CCTTTCTGGGCACCTCCCTCAGG + Intronic
1122938910 14:104972553-104972575 CTGTGCAGGGCACCTCCCTCTGG - Intronic
1128096501 15:64960368-64960390 CTCCCCAGGGCAGCTGCCTCTGG + Intergenic
1129783181 15:78288199-78288221 TTTACTAGGGCTCCTCCCTAGGG + Intronic
1136687219 16:32002665-32002687 GTCATCAGGGCACCCCCCTCTGG + Intergenic
1136787832 16:32946216-32946238 GTCATCAGGGCACCCCCCTCTGG + Intergenic
1136881951 16:33907573-33907595 GTCATCAGGGCACCCCCCTCTGG - Intergenic
1137274543 16:46924800-46924822 CTCACCTGGGCACCGCCCTTGGG - Intronic
1137712413 16:50575512-50575534 CTTTCCAGGGCTCCTTCCCCGGG + Intronic
1137808018 16:51325825-51325847 CAGGCCAGAGCACCTCCCTCTGG + Intergenic
1139017795 16:62711376-62711398 CTGGCGAGGGCCCCTCCCTCAGG + Intergenic
1141429598 16:83964862-83964884 CTAACAAGGGTGCCTCCCTCAGG - Intronic
1203090060 16_KI270728v1_random:1207873-1207895 GTCATCAGGGCACCCCCCTCTGG + Intergenic
1142530379 17:575731-575753 TTTCCCAGAGAACCTCCCTCAGG + Intronic
1142530496 17:576496-576518 GTTCCCAGAGAACCTCCCTCAGG + Intronic
1142530528 17:576688-576710 ATTCCCAGAGAACCTCCCTCAGG + Intronic
1142530582 17:576981-577003 CTTAGCAGAGAACCTCCCTCAGG + Intronic
1142530634 17:577334-577356 GTTACCACAGAACCTCCCTCAGG + Intronic
1142530715 17:577851-577873 ATTACCAGAGAACCACCCTCAGG + Intronic
1142530893 17:579011-579033 GTTACCAGAAAACCTCCCTCAGG + Intronic
1142530906 17:579076-579098 ATTACCAGAGAACCTTCCTCAGG + Intronic
1142531009 17:579689-579711 ATTACCAGAGAACCACCCTCAGG + Intronic
1142531062 17:579980-580002 GTTACCAGAAAACCTCCCTCAGG + Intronic
1142531075 17:580045-580067 ATTACCAGAAAACCTCCCTCAGG + Intronic
1142531167 17:580561-580583 ATTGCCAGAGAACCTCCCTCAGG + Intronic
1142531181 17:580625-580647 GTTCCCAGAGAACCTCCCTCAGG + Intronic
1142531257 17:581101-581123 ATTCCCAGAGAACCTCCCTCAGG + Intronic
1142531281 17:581262-581284 GTTTCCAGAGAACCTCCCTCAGG + Intronic
1142531475 17:582387-582409 GTTCCCAGAGAACCTCCCTCAGG + Intronic
1142531559 17:582903-582925 GTTCCCAGAGAACCTCCCTCAGG + Intronic
1142531746 17:583972-583994 GTTCCCAGGGAACCTCCCTCAGG + Intronic
1143014315 17:3883591-3883613 CTTACCTGGGCCACACCCTCAGG - Intronic
1143252992 17:5536708-5536730 CTGACAAGTGCACCTCACTCTGG + Intronic
1143266190 17:5639729-5639751 CTTTCCAGGGCCCCTTCCTCAGG - Intergenic
1143392421 17:6567648-6567670 CTTGTCAGGGCACCTCGCACAGG - Intergenic
1143660929 17:8324268-8324290 CTTCCCAGGGCTACTTCCTCTGG - Intergenic
1146639469 17:34529082-34529104 CTTTCCAGGATACCTCTCTCAGG - Intergenic
1146947863 17:36886011-36886033 CCAACCTGGGCACCTCCCGCTGG + Intergenic
1147148197 17:38498334-38498356 GTCATCAGGGCACCCCCCTCTGG + Intronic
1147976230 17:44249708-44249730 CTCACCAGGACGCCTCTCTCTGG + Exonic
1148976364 17:51533472-51533494 GTTACCAGGGCTCTGCCCTCAGG + Intergenic
1149375196 17:56036842-56036864 CTTTCCATGACACCTCCTTCTGG - Intergenic
1150281070 17:63929941-63929963 CCTACAAGGGCAGCTCCCTCAGG + Intronic
1151656586 17:75499090-75499112 GTCAGCAGGGCGCCTCCCTCTGG + Intronic
1151937590 17:77272346-77272368 CTGACCAGGGCACCTACGTGGGG + Intergenic
1152649347 17:81484684-81484706 CCAACCAGAGCAGCTCCCTCTGG - Intergenic
1156418800 18:36927928-36927950 CTTACGAGGGCACTCCCATCCGG - Intronic
1157616835 18:48992113-48992135 CTTACCCGGGCACCTCATGCTGG + Intergenic
1158464164 18:57674974-57674996 TTTACCAGGGCACCTTCATCGGG + Exonic
1159823188 18:73172837-73172859 CTTCCCAGAGCAACTCCCCCAGG - Intronic
1161250313 19:3276474-3276496 CTTCCCAGGGCCTCTCCCCCTGG - Intronic
1161322440 19:3647431-3647453 CATGCCAGGCCACCTCACTCAGG + Intronic
1161729317 19:5949426-5949448 CTGACCAGGGCTCTTCCCTCAGG - Intronic
1161909829 19:7184881-7184903 CCTCCCTGGGCCCCTCCCTCAGG - Intronic
1162073922 19:8171961-8171983 CATACCTGGACACCTCACTCCGG - Intronic
1162509136 19:11106758-11106780 CTGACCAGGGAAGCGCCCTCTGG - Intronic
1165309778 19:35023000-35023022 CATGCCAGGCCACCTCCCTGGGG - Intronic
1166452324 19:42912871-42912893 CCTACCTGGCCACCTCCATCTGG + Intronic
1166999852 19:46739305-46739327 CTTACCAGAGCATCTGTCTCTGG + Intronic
925199399 2:1954040-1954062 CTTACTAGTGCAACACCCTCAGG + Intronic
928129699 2:28640833-28640855 CACACCAGAGCCCCTCCCTCGGG - Intronic
930770021 2:55121352-55121374 CTTACCAGGGCAATTCCTTGTGG - Intergenic
933006187 2:76998376-76998398 CTTCCCAGGGCACCTACAGCTGG + Intronic
933900714 2:86848107-86848129 CTTACAAAGGCACCTTCCTGAGG + Intronic
935579722 2:104746113-104746135 CTTACCAGGTGACCTCCCATCGG - Intergenic
937239166 2:120449320-120449342 CTTTCCTAGGAACCTCCCTCGGG - Intergenic
940275285 2:151933661-151933683 CTGACCATGGCACCACCTTCTGG - Intronic
940991586 2:160102722-160102744 CTTACCCAGACACCTTCCTCCGG - Intronic
942276508 2:174327393-174327415 CTTACCAGGGCACATGCCAGCGG - Intergenic
948455207 2:238101581-238101603 CTTCCCAGGACACCTACCTCTGG - Intronic
948731523 2:239966765-239966787 CCGCCCAGGGCCCCTCCCTCAGG - Intronic
1171201428 20:23245131-23245153 CCCACCTGGCCACCTCCCTCAGG + Intergenic
1172588452 20:36101261-36101283 CTCTCCAGGCCACCTCCCTCTGG - Intronic
1174402304 20:50282659-50282681 CTTCCAAGGGCACCTCCCCAAGG + Intergenic
1174555259 20:51390659-51390681 CTGACCAGGGCACCTAGCCCTGG - Exonic
1175296172 20:57910219-57910241 CTTAGCTGGGCACATCCCTTTGG - Intergenic
1176053742 20:63134227-63134249 GTTTCCAGGGCCCCTCCTTCAGG - Intergenic
1179607307 21:42525101-42525123 CTCGCCAGGGCTCCACCCTCCGG - Intronic
1179792274 21:43762552-43762574 CTTCCCAGGGCAGAGCCCTCAGG + Intergenic
1179818068 21:43920726-43920748 CTCCCCAGGGCTCCACCCTCCGG - Intronic
1181037430 22:20176597-20176619 CCCACCAGGGCAGGTCCCTCAGG + Intergenic
1181325081 22:22038704-22038726 CTTCCCAGGGCTCCTCCCCTGGG - Intergenic
1182516823 22:30863736-30863758 CTGACCAGTGGACCTCCCTCGGG - Intronic
1183976744 22:41516625-41516647 GCTACCAGGCCACCTGCCTCAGG - Intronic
1185058095 22:48591705-48591727 CTGGCCATGGCCCCTCCCTCAGG - Intronic
949670842 3:6398058-6398080 CGGATCAGGGCACCTCCCTTGGG + Intergenic
950109544 3:10410298-10410320 ATTACCATGGCAGCTACCTCAGG + Intronic
950642675 3:14358671-14358693 CCTGCCAGGGCGCCTCCCTCTGG - Intergenic
952006752 3:28850146-28850168 CTTTCCAGGGCACCTCTGTCAGG + Intergenic
952731993 3:36648023-36648045 CTTTCCAGCTCACCTCTCTCAGG - Intergenic
953202195 3:40787554-40787576 CTTACCAGGGCACTTCCTAGTGG + Intergenic
954317845 3:49810979-49811001 CTCACCAGGGCACAGTCCTCAGG + Exonic
954791229 3:53134934-53134956 CGTCCCAGAGCACCTCCATCAGG + Intergenic
958560939 3:95745375-95745397 CTGACCACCCCACCTCCCTCCGG - Intergenic
962148724 3:132870013-132870035 GTTATCAGAGAACCTCCCTCTGG + Intergenic
963800566 3:149671953-149671975 CTTACCTGGGGACCTCACCCAGG - Intronic
966404835 3:179585736-179585758 CTTACCAAGGAATCTGCCTCTGG - Intronic
972388174 4:38587731-38587753 AATATCAGGGCCCCTCCCTCAGG + Intergenic
974391058 4:61269098-61269120 CTTATCAGTGCAGCTCCCTTGGG - Intronic
980445475 4:132900935-132900957 CTTACCAGGGCACATTTCCCAGG + Intergenic
981577776 4:146223014-146223036 ATAACCACAGCACCTCCCTCAGG + Intergenic
982803326 4:159731693-159731715 CTTTCCAGTTGACCTCCCTCAGG + Intergenic
990556463 5:56941539-56941561 CTTAGCAGGGAACCACCTTCAGG - Intronic
995825254 5:116289647-116289669 CATGCCAGAGCTCCTCCCTCAGG - Intronic
997679151 5:135737050-135737072 CGGATCAGGGGACCTCCCTCGGG - Intergenic
1000153122 5:158522921-158522943 GTTACAAGGGCCCCTCCCTTTGG - Intergenic
1001656242 5:173352612-173352634 CCTACCTGCACACCTCCCTCAGG - Intergenic
1002449957 5:179313146-179313168 CTTACCGGGGCTCCCTCCTCAGG + Intronic
1002835403 6:861317-861339 CTTCCCTGGGCCCCTCCCTTTGG - Intergenic
1005711912 6:28511455-28511477 CTAACTAGGGCTCCACCCTCGGG + Intronic
1006866479 6:37212981-37213003 TTTACCAGAGCACCTCCTGCAGG + Exonic
1007072169 6:39045894-39045916 GTTACCAGGGCCTCTCACTCAGG - Intergenic
1007167784 6:39841054-39841076 CTTCCCAGCGCCCCTCCCCCTGG - Intronic
1007167858 6:39841234-39841256 CTTCCCAGCGCCCCTCCCCCTGG - Intronic
1011505159 6:88033641-88033663 CCTACCCGGCCACCTCCTTCAGG - Intergenic
1014560599 6:122885300-122885322 CTTTCCAGGGCACCACACTGAGG + Intergenic
1015482371 6:133726958-133726980 CATACTAGGGCTCCTCCCTAAGG + Intergenic
1017949186 6:159121407-159121429 CTTCTCAGGGCACCTCTGTCTGG - Intergenic
1018854344 6:167664730-167664752 CTCACCTGGTCACCTCCCCCTGG - Intergenic
1021313016 7:19116453-19116475 CTCACCAGGGCGCATCCCCCTGG + Intronic
1024212287 7:47216329-47216351 CTTACAAGGGCACAGCCCTATGG + Intergenic
1024589112 7:50865694-50865716 CGTACCAGGGCCACTCCCTGTGG - Intergenic
1026986846 7:74560108-74560130 CTTACCTGGGCTCCTGCCCCAGG + Intronic
1028674095 7:93438649-93438671 CGTCCCAGGTCACATCCCTCCGG - Intronic
1031061215 7:117053605-117053627 CTCAGCAGGCCACCTCCTTCTGG + Intronic
1033635775 7:143210074-143210096 CTGACAAGGGCTCCACCCTCGGG - Intergenic
1034172427 7:149072355-149072377 CTGACCAAGGCATCACCCTCGGG - Exonic
1034336194 7:150325026-150325048 ATTACCTGGGCAGCCCCCTCTGG + Intronic
1034772543 7:153794109-153794131 CCTACTAGGGCACCTCCCAGTGG + Intergenic
1035317795 7:158007513-158007535 CCTCACAGGGCACCTCCCACAGG + Intronic
1035358819 7:158296360-158296382 CTTCCCAGTCCATCTCCCTCTGG + Intronic
1036793249 8:11737406-11737428 ATTGCCAGGGCAGCTCCCTCAGG - Intronic
1041393333 8:57367312-57367334 CTTACCAGACCATCTGCCTCAGG + Intergenic
1041824812 8:62082617-62082639 CTTGCAAGACCACCTCCCTCAGG - Intergenic
1044716280 8:95102655-95102677 CTTACCAGGGCACCTCCCTCAGG - Intronic
1044953146 8:97452857-97452879 CTTGCCTGGGCGCCCCCCTCTGG - Intergenic
1048877296 8:138846971-138846993 CTTCCCAGGGCTCCTCCTCCTGG + Intronic
1049325465 8:142019317-142019339 CTGACTTGGGCACCTCCCTCAGG + Intergenic
1049577114 8:143394523-143394545 CTCACCAGGGCAGCACCCGCTGG - Intergenic
1049955422 9:688658-688680 CATACCTGGTCACCTCTCTCTGG - Intronic
1050119887 9:2297449-2297471 CTTACCAGGGAACCACCCAAAGG - Intergenic
1053475982 9:38382270-38382292 CTTACCGGGCCCCCACCCTCTGG - Intergenic
1055696501 9:78890628-78890650 CTTAGCAGGGCACATTCTTCCGG + Intergenic
1056938027 9:90932802-90932824 CTATCCTGGGCACCTCACTCAGG + Intergenic
1058421154 9:104834772-104834794 GGTCCCAGGGCACCTCTCTCGGG - Intronic
1059426524 9:114224433-114224455 CTTCCCAGGGCTCCTTCTTCAGG + Intronic
1059730983 9:117056672-117056694 TTTACCAAGGCACCTCTCCCTGG + Intronic
1061487199 9:130925928-130925950 CTTTGCAGGGCCCCTGCCTCTGG - Intronic
1061521616 9:131121579-131121601 CAGTCCAGGGCACCTCCCTCTGG - Exonic
1061757300 9:132824125-132824147 CAAACCAGGTCACCTCCCGCTGG + Intronic
1187712512 X:22068253-22068275 CTCACCAGGCCTCCTACCTCTGG + Intronic
1188093827 X:25997420-25997442 CTTAGCAAGGCAACTCCCTTTGG - Intergenic
1188262540 X:28037270-28037292 TTTACCAGTGCATCTCCATCTGG - Intergenic
1188501407 X:30831001-30831023 CTTACCTGGTCACCGCTCTCTGG - Exonic
1190752813 X:53376901-53376923 TTTAACTGGGCACTTCCCTCTGG - Exonic
1191927446 X:66329043-66329065 GCTACAAGGGCACCTCTCTCCGG + Intergenic
1193527868 X:82616234-82616256 TTTACCAGGCCAGCCCCCTCAGG - Intergenic
1194105965 X:89767718-89767740 CTTGCAAGGGCTCCACCCTCAGG + Intergenic
1195619821 X:106941938-106941960 CTTTCTAGGTCATCTCCCTCTGG + Exonic
1196176513 X:112644680-112644702 CTTGCCTGGGCACCTCACTTTGG - Intronic
1200457922 Y:3415577-3415599 CTTGCAAGGGCTCCACCCTCAGG + Intergenic