ID: 1044716282

View in Genome Browser
Species Human (GRCh38)
Location 8:95102668-95102690
Sequence TCAGTACCAGCAGCTTACCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 275
Summary {0: 1, 1: 1, 2: 62, 3: 45, 4: 166}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044716282_1044716289 27 Left 1044716282 8:95102668-95102690 CCCTGGTAAGCTGCTGGTACTGA 0: 1
1: 1
2: 62
3: 45
4: 166
Right 1044716289 8:95102718-95102740 GTGTTGCAAGAGCTGGACACTGG No data
1044716282_1044716288 20 Left 1044716282 8:95102668-95102690 CCCTGGTAAGCTGCTGGTACTGA 0: 1
1: 1
2: 62
3: 45
4: 166
Right 1044716288 8:95102711-95102733 GCTGTCAGTGTTGCAAGAGCTGG No data
1044716282_1044716286 -4 Left 1044716282 8:95102668-95102690 CCCTGGTAAGCTGCTGGTACTGA 0: 1
1: 1
2: 62
3: 45
4: 166
Right 1044716286 8:95102687-95102709 CTGAAGGAGCCAGGTGCTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044716282 Original CRISPR TCAGTACCAGCAGCTTACCA GGG (reversed) Intronic
901331791 1:8414888-8414910 TCAGTCCCAGCTGCTCAGCATGG - Intronic
901438257 1:9262573-9262595 TCAGTCCCAGATGCTTCCCAAGG + Intronic
903007203 1:20306598-20306620 TGAGTGCCAGCAGCCTCCCAAGG - Intronic
906491692 1:46273619-46273641 CCAGGACCAGCATCTTACCTGGG - Exonic
906708770 1:47914024-47914046 GCAGTTCCAGCACTTTACCAAGG - Intronic
907045793 1:51299388-51299410 TCAGACCCAGCAGCTGACCTCGG + Intronic
909729622 1:78875621-78875643 TCAGTCCCAGCAGCTTACCTGGG + Intergenic
910072305 1:83231903-83231925 TTAGTACCAGCATATTAGCAAGG + Intergenic
911091957 1:94024283-94024305 TCAGAACAAGCAGCTTGACAGGG - Intronic
911967105 1:104383516-104383538 TCAGTCCCAGCAACTTTCCTGGG + Intergenic
912651866 1:111447107-111447129 TCAGTACCACCTGCTGAGCAAGG + Exonic
913245312 1:116865434-116865456 TCAGTCCCAGCAGCTTACCTGGG + Intergenic
914050614 1:144127203-144127225 TCAGTACCATCAGCCTGGCAAGG + Intergenic
914128568 1:144838242-144838264 TCAGTACCATCAGCCTGGCAAGG - Intergenic
915069134 1:153251574-153251596 TCCCTTCCAGCAGCCTACCAGGG + Intergenic
916692766 1:167206608-167206630 TCAGTACAAGAAGATCACCAGGG + Intergenic
917526890 1:175796160-175796182 TCAGAAACAGTAGCTCACCATGG + Intergenic
919837333 1:201583860-201583882 TCAGGACCTTCAGCTTCCCAGGG + Intergenic
920427175 1:205887689-205887711 TCAGCCTCAGCAACTTACCAGGG - Intergenic
920908188 1:210190605-210190627 TCAGTCCCAGCAGCTTGCCTGGG + Intergenic
921935351 1:220790597-220790619 TCACTTCCAGCAGGTTATCATGG - Intronic
923075396 1:230604548-230604570 ACAGTCCCAGCAGCTTACCTGGG + Intergenic
924422706 1:243924360-243924382 TCCATACCAGCAGCTTGACACGG - Intergenic
1065593444 10:27289055-27289077 TCAGTGTCAGCTGTTTACCATGG - Intergenic
1069055840 10:63843950-63843972 TCTGTACCAGTAGCTTCTCAGGG - Intergenic
1070263423 10:74879733-74879755 TCAGCACCAGAAGCTTAGAAAGG - Intronic
1070586185 10:77768357-77768379 TCAGGACAAGAAGCTTACCTTGG - Intergenic
1071187419 10:83060476-83060498 TCAGTCCCAGCAGTTTACCTGGG + Intergenic
1073130763 10:101187756-101187778 TCAGTCCCAGCAACTTACCTGGG - Intergenic
1073394861 10:103209221-103209243 TCAGTCTCAGCAACTTACCCGGG + Intergenic
1074740967 10:116483979-116484001 TCAGTCCCAGCAGCTTACCTGGG + Intergenic
1075080568 10:119380923-119380945 TCAGGAGCAGGAACTTACCACGG - Exonic
1076391632 10:130107734-130107756 TCTGGACCATCAGATTACCAAGG + Intergenic
1076686958 10:132202500-132202522 TCAGTTCCAGCATCTTGCTAGGG + Intronic
1078789174 11:14525788-14525810 TCAGTCCCAGCAGCTTACCTGGG + Intronic
1079158036 11:17967185-17967207 TCAGAGCCAGCAGCTTTCAATGG + Intronic
1079376969 11:19901725-19901747 TCAGAACCAGCAACTTACACTGG + Intronic
1080214318 11:29823630-29823652 TCACTACCAGTAACTTACCTAGG - Intergenic
1081159886 11:39737730-39737752 TCGGTCCCAGCAGCTTACCTGGG + Intergenic
1081997602 11:47375386-47375408 ACAGAACCAGCAGATAACCATGG + Intronic
1084354387 11:68627469-68627491 TCAGTCCCAGCGGCTTACCTGGG + Intergenic
1084391124 11:68877764-68877786 ACAGCACCCGCAGCTCACCATGG - Intergenic
1085252207 11:75151319-75151341 TCAGGACCTGGAGCTTAGCAGGG - Exonic
1085570375 11:77553201-77553223 TCAGTCTCAGCAACTTACCTGGG + Intronic
1085627479 11:78084309-78084331 TCAGTCCCAGCAACTTACCTGGG + Intergenic
1089254466 11:117186997-117187019 ACAGCACCTGGAGCTTACCAAGG - Intronic
1091783589 12:3229255-3229277 TCTGTACCAGCCTCCTACCAAGG + Intronic
1092924668 12:13262348-13262370 TCAGTGCCAGCAGCTTGCCTGGG - Intergenic
1093302482 12:17473278-17473300 TCAGTCTCAGCAACTTACCTGGG + Intergenic
1093358613 12:18198286-18198308 TCAGTACCAGCAGCTTACCTGGG + Intronic
1093767736 12:22983773-22983795 TCAGAACCAGCACCTACCCAGGG - Intergenic
1094825925 12:34268958-34268980 TCAGTCCCAGCAGCTTACCTGGG + Intergenic
1096486479 12:51985371-51985393 TCAGTAGAAGCTGCTTAGCAAGG - Intronic
1096671390 12:53200401-53200423 TCAGGACCAGCAGCAAAACAAGG + Exonic
1097592482 12:61589817-61589839 TCAGTCCCAGAAGCTTACCTGGG + Intergenic
1098506631 12:71259663-71259685 GCAATACTAGCAGCTTAACAAGG + Intronic
1098920082 12:76294789-76294811 TCAGTCCCAGCAGCTTACCTGGG + Intergenic
1099872977 12:88371007-88371029 TCAGTCCCAGCAGCTTACCTGGG + Intergenic
1101568815 12:105934612-105934634 TCAGGACCAGCAATTTCCCAGGG - Intergenic
1101838388 12:108310880-108310902 CCAGAACCTGCAGCTCACCAGGG + Intronic
1102604666 12:114059172-114059194 TCAGTCCCAGCAGCTTACCTGGG + Intergenic
1104257800 12:127155125-127155147 TCAGTCTCAGCAACTTACCTGGG + Intergenic
1105032411 12:132893039-132893061 TCGGTCCCAGCAGCTTACCTGGG + Intronic
1107016912 13:35714803-35714825 GCAGCACCAGCAGCTTCCCAGGG + Intergenic
1108590552 13:51908914-51908936 TCTGGACCACCAGATTACCAAGG - Intergenic
1109084336 13:57951052-57951074 TGAGTGTCTGCAGCTTACCAAGG + Intergenic
1109126986 13:58530311-58530333 TCTGGACCACCAGATTACCAAGG + Intergenic
1109343761 13:61091688-61091710 TCAGTCCCAGCAGCTTACCTGGG + Intergenic
1115115550 14:29877234-29877256 TCCCTACCAGCAGTGTACCAGGG - Intronic
1118937071 14:70298181-70298203 TCAGTCCCAGCAGCTTACCTAGG - Intergenic
1119773968 14:77237239-77237261 TAAGTAGCAGCAGCTCAGCAGGG - Intronic
1120659774 14:87237420-87237442 TCAGTCCCAGCAGCTTACCTGGG - Intergenic
1121193104 14:92047094-92047116 TCAGTCCCAGCAGCTTACCTGGG - Exonic
1121289612 14:92763198-92763220 TCAGTCCCAGCAGCTTACCTGGG + Intergenic
1121327963 14:93032761-93032783 TGAGTCCCAGCAACTCACCAGGG - Intronic
1121961759 14:98266527-98266549 TCAGTATCAGGAGCTCCCCATGG - Intergenic
1122733466 14:103820129-103820151 TCAGTCCCAGCAACTTCCCTAGG + Intronic
1123420484 15:20126512-20126534 TCAGTACCATCAGCCTGGCAAGG + Intergenic
1123445375 15:20327012-20327034 TCAGTACCATCAGCCTGGCAAGG - Intergenic
1123529708 15:21133048-21133070 TCAGTACCATCAGCCTGGCAAGG + Intergenic
1125554201 15:40570627-40570649 TCAGTAACACTAGTTTACCATGG + Intronic
1125629406 15:41134832-41134854 TCAGTCTCAGCAGCTTACCTGGG + Intergenic
1126843932 15:52741910-52741932 TCAGTCCCAGCAGCTTACCTGGG + Intergenic
1131045669 15:89312968-89312990 TCAGTGTCAGCAGCTTACCATGG - Exonic
1133766571 16:8842472-8842494 TCAGTCCCAGCAGCTTACCTGGG - Intronic
1136530112 16:30862380-30862402 TCAGTCTCAGCAACTTACCTGGG + Intronic
1136721377 16:32321584-32321606 TCAGTACCATCAGCCTGGCAAGG + Intergenic
1136839758 16:33527872-33527894 TCAGTACCATCAGCCTGGCAAGG + Intergenic
1137055185 16:35742404-35742426 TCAGTCCCAGCAGCTTACCTTGG - Intergenic
1137966762 16:52942318-52942340 CAAGTATCAGCACCTTACCAAGG + Intergenic
1203005055 16_KI270728v1_random:196186-196208 TCAGTACCATCAGCCTGGCAAGG - Intergenic
1203136605 16_KI270728v1_random:1732305-1732327 TCAGTACCATCAGCCTGGCAAGG - Intergenic
1203149926 16_KI270728v1_random:1828157-1828179 TCAGTACCATCAGCCTGGCAAGG + Intergenic
1143577662 17:7804070-7804092 TCATTGCCAACAGCTTCCCAAGG - Intronic
1147546937 17:41408989-41409011 TCAGTACCAGCTGCTCCCCTTGG - Intergenic
1150514847 17:65797360-65797382 CCAGTACCAGCATCTAACCCTGG + Intronic
1151969382 17:77450079-77450101 CCAGTAGCAGCAGCTCCCCACGG + Intronic
1153711988 18:7809423-7809445 GCGGTCCCAGCAGCTGACCATGG - Intronic
1153881533 18:9425661-9425683 TCAGTCCCAGCAGCTTACCTGGG - Intergenic
1156397805 18:36715071-36715093 TCAGTTCCATCAGCTTTCCAGGG - Intronic
1156915996 18:42464898-42464920 TCAGTCCCAGCAGCTTACCTGGG + Intergenic
1156936818 18:42719363-42719385 ACAGTATCAGCAGTTTAGCAGGG - Intergenic
1157690548 18:49678460-49678482 TCAGTCCCTGGAGGTTACCAAGG - Intergenic
1159104024 18:63985241-63985263 TCATTGCCTGGAGCTTACCACGG - Exonic
1161283289 19:3456921-3456943 TCATTACCACCTGCTTCCCATGG + Intronic
1161712303 19:5855749-5855771 TCAGTCCCAGCAGCTTACCTGGG + Intergenic
1162055408 19:8060662-8060684 CCAGTACCCTCAGCTTACCAGGG + Intronic
1162063887 19:8112791-8112813 TTAGTAACAGCAGCTCACCAAGG - Intronic
1162262400 19:9543567-9543589 TCAGTCTCAGCAACTTACCTGGG + Intergenic
1163900029 19:20093000-20093022 TCAGTCCCAGCAGCTTACCTGGG - Intronic
1164003906 19:21132165-21132187 TCAGTCCCAGCAGCTTACCTGGG - Intergenic
1164080980 19:21861131-21861153 TCAGCCTCAGCAGCTTACCTAGG + Intergenic
1164436090 19:28230770-28230792 TCAGACCCAGCAGCCTGCCAGGG + Intergenic
1164746968 19:30623539-30623561 TCAGGCCCAGCAGCCTCCCAGGG + Intronic
1166905601 19:46106434-46106456 TCAGTCCCAGCAACTTACCTGGG - Intergenic
1167901290 19:52624060-52624082 TCAGTCCCAGCAGCTTACCTGGG + Intronic
1202690021 1_KI270712v1_random:79841-79863 TCAGTACCATCAGCCTGGCAAGG + Intergenic
929383729 2:41381268-41381290 TCAGTCCCAGCAACTTACCTGGG + Intergenic
930098888 2:47588045-47588067 TCAGTCCCAGCAGCTTACCTGGG - Intergenic
932143575 2:69299988-69300010 TCAGGACCAGGAGCTTCCCTGGG - Intergenic
932159269 2:69446033-69446055 TCAGTCTCAGCAGCTTACCTGGG - Intergenic
932265423 2:70363614-70363636 CCAGCACCATCAGTTTACCATGG + Intergenic
932367061 2:71160318-71160340 TCAGTCCCAGCAGCTTACCTGGG - Intergenic
933956394 2:87376182-87376204 TCAGTACCATCAGCCTGGCAAGG - Intergenic
934240542 2:90268207-90268229 TCAGTACCATCAGCCTGGCAAGG - Intergenic
934272651 2:91548550-91548572 TCAGTACCATCAGCCTGGCAAGG + Intergenic
935280414 2:101512585-101512607 TGGGTTCCAGGAGCTTACCAAGG + Intergenic
935554044 2:104487635-104487657 TCTCTACCAGCAGTTTACGAAGG - Intergenic
936148712 2:109998463-109998485 TCAGTACCATCAGCCTGGCAAGG + Intergenic
936195966 2:110372905-110372927 TCAGTACCATCAGCCTGGCAAGG - Intergenic
936226128 2:110654118-110654140 TCCGTACCAGTAACTTCCCATGG - Intronic
937242033 2:120468074-120468096 GCATCACCAGCAGCTGACCAAGG - Intergenic
940183879 2:150961636-150961658 TCAGTCCCAGCAACTTACCTGGG + Intergenic
941297612 2:163759767-163759789 TCAGTAGCAGCATCTAAGCAAGG - Intergenic
944251212 2:197581434-197581456 TCAGTCCCAGCAGCTTACCTGGG + Intronic
945173637 2:207020577-207020599 TCAGTCCCAGCAGCTTACCTGGG + Intergenic
945301306 2:208218616-208218638 TCAGTCCCAGCAGCTTACCTGGG - Intergenic
946362531 2:219228085-219228107 TCAGTTCCAGCTGCTGCCCATGG + Intronic
946471916 2:219968578-219968600 TCTATCCCAGCAGCTTTCCATGG - Intergenic
947024645 2:225723355-225723377 TCAGGACCAGAAGGGTACCATGG + Intergenic
947586410 2:231359552-231359574 CCAGGACCAGGAGCTTCCCAGGG - Intronic
1169180149 20:3557367-3557389 TCAGTACCAGCAGTGTTCAAGGG + Intronic
1171017667 20:21556604-21556626 TCAAAACCAGGAACTTACCATGG + Intergenic
1172932284 20:38595092-38595114 TCAGTCCCAGCAGCTTACCTGGG - Intergenic
1173652227 20:44673689-44673711 TCAGTCCCAGCAGCTTACCTGGG + Intergenic
1173871409 20:46344308-46344330 TCAGAACCAACAGCTTCCCAGGG + Intergenic
1173928830 20:46801275-46801297 TCAGTACCCCCAGTTTACAATGG + Intergenic
1176107489 20:63396259-63396281 TCAGAACCACCAGGTCACCAGGG - Intergenic
1176910484 21:14559326-14559348 TCAGTAGTATCACCTTACCAAGG + Intronic
1177100805 21:16895493-16895515 TCAGTCCCAGCAGCTTACCTGGG + Intergenic
1177161840 21:17556212-17556234 TCTGTTCCAGCAGAGTACCATGG + Intronic
1177781046 21:25622668-25622690 TCAGAACCAGCAGCTTTCTGGGG + Intergenic
1180551400 22:16544725-16544747 TCAGTACCATCAGCCTGGCAAGG - Intergenic
1181352607 22:22269201-22269223 TCAGTACCATCAGCCTGGCAAGG + Intergenic
1182635311 22:31721855-31721877 TCAGTACTATCAAATTACCATGG - Intronic
1183045321 22:35214866-35214888 TCAGTACCATCAGATTACCTGGG - Intergenic
1183635478 22:39059857-39059879 TCAGTCCCAGCAGCTTACCTGGG - Intronic
1183636641 22:39067663-39067685 TCAGTCCCAGCAGCTTACCTGGG - Intronic
1183718262 22:39546990-39547012 TCAGTGCTAGGAGCTGACCATGG - Intergenic
1184057244 22:42060777-42060799 TCAGTGCCTGCAGCTCCCCATGG + Intronic
1185292694 22:50035132-50035154 CCAGTACCAGCAGCTGCCCCAGG + Intronic
950089669 3:10286749-10286771 TCAGTACCAGCAGCACAGCCAGG - Exonic
951894793 3:27600478-27600500 TCAGTCCCAGCAGCTTACCTGGG + Intergenic
952297057 3:32070909-32070931 TCAGTCCCAGCAGCTTACCTGGG + Intronic
952827802 3:37538503-37538525 TCAGAACTAGCAGCCTCCCAGGG + Intronic
952895038 3:38073048-38073070 TCAGTCCCAGCAGCTTACCTGGG - Intronic
953328396 3:42031942-42031964 TCAGAGCCAGCAGCTTTGCAGGG - Intronic
953599249 3:44347410-44347432 TCAGTCTCAGCAACTTACCTGGG - Intronic
953656374 3:44858062-44858084 TCAGTCCCAGCAGCTTACCTGGG - Intronic
953834312 3:46329883-46329905 TCAGTCTCAGCAACTTACCTGGG - Intergenic
954151269 3:48658428-48658450 TCAGGAACAGCAGCTTACTATGG - Intronic
957456085 3:80448392-80448414 TAAGTACCAGCATGTTAACAGGG + Intergenic
957904674 3:86540764-86540786 TCAGTTCCAGTAGCTTACCTGGG - Intergenic
958981545 3:100726149-100726171 CTTGTACCAGCAGCTTCCCAGGG - Intronic
961324201 3:126100489-126100511 CCACTACCAGCAGCTCACCAGGG - Intronic
962205756 3:133432447-133432469 TCAGTCCCAGCAGCTTACCTGGG + Intronic
963319917 3:143800615-143800637 TCAGTCCCAGCAGTTTACCTGGG + Intronic
963355104 3:144201558-144201580 TCTGTACCAGCAGCACACTATGG - Intergenic
964216457 3:154290116-154290138 TCAGTAACAGCAGTCTACCTAGG + Intronic
964244749 3:154638389-154638411 ACAGTACCACCATCTTACCCAGG - Intergenic
964984705 3:162724908-162724930 TCAGTCCCAGCAGCTTACCTGGG - Intergenic
965335281 3:167425922-167425944 CCAGTCCCAGCAGCTTACCTGGG + Intergenic
965624706 3:170674903-170674925 TCAGCCCCAGCAGCTTACCTGGG - Intronic
965639853 3:170820343-170820365 TCAGTCCCAGCAGCTTACCTGGG - Intronic
965807616 3:172558460-172558482 TCAGTAACAGGAGCTTACTATGG + Intergenic
969653900 4:8485158-8485180 TCAGTCCCAGCAGCTTACCTGGG - Intronic
974903958 4:68033943-68033965 TCAGTCCCAGCAGCTTACCTGGG + Intergenic
976739776 4:88346143-88346165 TCAGTCTCAGCAACTTACCTGGG - Intergenic
977050171 4:92119558-92119580 TCAGTACCTGCAGCTTTTCCAGG - Intergenic
977381488 4:96279782-96279804 TAAGTTGCAGAAGCTTACCATGG + Intergenic
982083796 4:151814993-151815015 TCAGTCCCAGCAGCTTACCTTGG - Intergenic
982318994 4:154059602-154059624 TCAGTCCCAGTAGCTTACCTGGG + Intergenic
982550222 4:156788453-156788475 TCAGTATCAGAAACTTAGCAGGG + Intronic
988438634 5:31206890-31206912 TCACTACCAAAAGCTTAACATGG + Intronic
989117138 5:37965824-37965846 TCAGTACAGGCTGGTTACCACGG - Intergenic
989614985 5:43330323-43330345 TCAGTCCCAGAAGCTTACCTCGG - Intergenic
989688741 5:44117103-44117125 TCAGTCTCAGCAACTTACCTGGG - Intergenic
991289274 5:65016644-65016666 TCAGTAGCTGCTGCTCACCAGGG - Intronic
992961010 5:81956584-81956606 TCAGGCTCAGCAGCTTACCTGGG + Intergenic
994325064 5:98437892-98437914 TCAGTCTCAGCAACTTACCTGGG + Intergenic
995296852 5:110533169-110533191 TCAGTCCCAGCAGATTACCTAGG + Intronic
996052449 5:118949276-118949298 TCAGTCTCAGCAACTTACCTAGG - Intronic
998441503 5:142166410-142166432 ACCGTATCAGCAGCTTATCAGGG + Intergenic
999151555 5:149429658-149429680 TCAGTACTAGTGGCTTTCCAGGG - Intergenic
999307753 5:150531391-150531413 TCACCATCAGCATCTTACCAGGG - Intronic
1001354123 5:171003773-171003795 TCAGTCCCAGTAGCTTACCTGGG - Intronic
1001546375 5:172573010-172573032 TCAGCACCAGGTGCTTCCCATGG + Intergenic
1001940840 5:175738411-175738433 TCAGTTCCAGCTGCTTCCCCAGG - Intergenic
1003099922 6:3169193-3169215 TCAGTCCCAGCAGCTTACCTGGG + Intergenic
1003338151 6:5194391-5194413 TCATTACCAGCCGCACACCAGGG - Intronic
1005053890 6:21711639-21711661 TCTTTACCAGCAGCTTCCAAGGG - Intergenic
1007300800 6:40866590-40866612 TCAGTCCCAGCAGCTTACCTGGG - Intergenic
1009464511 6:63953207-63953229 TTAGTCCCAGCAGCTTACCTGGG + Intronic
1010467261 6:76183227-76183249 TAAGTAGCAGCATCTTAGCACGG + Intergenic
1011726608 6:90216142-90216164 GCAGTTCCAGCAGCTGACCCTGG + Intronic
1014115171 6:117662101-117662123 TCAGTCCCAGCAGCTTACCTGGG - Intergenic
1017269978 6:152493436-152493458 TCAGTCTCAGCAACTTACCTGGG + Intronic
1018938164 6:168287602-168287624 TCCGGACCATCAGATTACCAAGG - Intergenic
1018981269 6:168603427-168603449 ACTGTCCCAGCAGCTTCCCAGGG - Intronic
1018991788 6:168679361-168679383 TCAGTCCCAGCAGCTTACCTGGG - Intergenic
1018992591 6:168685346-168685368 TCAGTCTCAGCAGCTTACACCGG + Intergenic
1020794385 7:12662865-12662887 TCAGTCCCAGCAGCTTACCTGGG + Intergenic
1021637499 7:22706569-22706591 TCAGTCCCAGCAGCTTACCTGGG + Intergenic
1023281226 7:38572662-38572684 GCTTTACCAGCAGCTTCCCATGG - Intronic
1024739072 7:52336027-52336049 TCAGTCTCAGCAACTTACCTAGG - Intergenic
1024748180 7:52431354-52431376 TCAGGACCTGCAGCCTGCCATGG - Intergenic
1025236649 7:57239278-57239300 TGAGTCCCAGCAGCTTCCCCGGG - Intergenic
1026633539 7:72060201-72060223 TAAGCACCTGCAGGTTACCATGG - Intronic
1026874310 7:73870852-73870874 TCAATACCAACAGCTGCCCAAGG - Intergenic
1027158496 7:75785253-75785275 TCAGTCCCCGCAGCTTACCAGGG + Intronic
1027290020 7:76696871-76696893 TTAGTACCAGCATATTAGCAAGG + Intergenic
1028589716 7:92482168-92482190 TCAGTCCCAGCAGCTTACCTGGG - Intergenic
1029317349 7:99726596-99726618 TCAGTCCCAGCAGCTTACCTGGG + Intronic
1031422288 7:121566371-121566393 TCAGTCCCAGCAGCTTACCTGGG - Intergenic
1034728817 7:153365650-153365672 TGAGTACCAGCAGCTTTTCCTGG + Intergenic
1034817002 7:154181189-154181211 TCAGAATCAGCAGTTTTCCAGGG - Intronic
1036639663 8:10574594-10574616 TCAGTCCCAGCAGCTTACCTGGG + Intergenic
1038171734 8:25141034-25141056 TCAGTAGGAGCAGTTTACCTTGG - Intergenic
1039498821 8:38001063-38001085 TCAGTCCCAGCAGCTTACCTGGG - Intergenic
1042741325 8:72050281-72050303 TCAGCACCAGCTGCTTCCCATGG - Intronic
1042756928 8:72224792-72224814 TCAGCACCAGATGCTTCCCATGG - Intergenic
1042991765 8:74648308-74648330 GCAGTACCCTCAGCTTACTAGGG + Intronic
1044716282 8:95102668-95102690 TCAGTACCAGCAGCTTACCAGGG - Intronic
1046934832 8:119875625-119875647 TCAGTCCCAGCAGCTTACCTGGG - Intronic
1049868645 8:144956645-144956667 TCGGTCCCAGCAGCTTACCTGGG - Intergenic
1050140658 9:2512765-2512787 TCAGTCCCAGCAGCTTACCTGGG + Intergenic
1053615564 9:39762018-39762040 CCAGCACCAGCAGCTGACCAGGG + Intergenic
1053898891 9:42773266-42773288 CCAGCACCAGCAGCTGACCAGGG - Intergenic
1054237956 9:62580373-62580395 CCAGCACCAGCAGCTGACCAGGG - Intergenic
1054262626 9:62882952-62882974 CCAGCACCAGCAGCTGACCAGGG + Intergenic
1054552087 9:66614883-66614905 CCAGCACCAGCAGCTGACCAGGG - Intergenic
1054976944 9:71158596-71158618 GCATTACCTGAAGCTTACCAAGG - Intronic
1058287786 9:103202297-103202319 TCATTTCCAAAAGCTTACCATGG - Intergenic
1058612571 9:106791527-106791549 ACAGTCCCAGCAGCTTACCTAGG + Intergenic
1062692130 9:137847444-137847466 TCGGTCCCAGCAGCTTACCTGGG + Intronic
1185976864 X:4731025-4731047 TCAGTTTCAGCAGCTTACAGAGG + Intergenic
1186364797 X:8879999-8880021 TCAGCACCAGTTGCTTCCCATGG - Intergenic
1187389303 X:18875422-18875444 CCAGCACCAGCAGCGTGCCAGGG - Intergenic
1187989118 X:24850356-24850378 TCTATACAAGCAGCTTATCATGG + Intronic
1188049910 X:25472290-25472312 TCAGTAAGATCAGCTTACAATGG + Intergenic
1188200779 X:27291521-27291543 TCAGTCCCAGCAACTTACCTGGG - Intergenic
1188300924 X:28505101-28505123 TCAGTCCCAGCAGCTTACCTGGG - Intergenic
1191761462 X:64652239-64652261 TCAGTCCCAGCAGCTTACCTGGG + Intergenic
1191805627 X:65132031-65132053 TCAGTCCCAGCAGCTTACCTGGG - Intergenic
1191825732 X:65363045-65363067 TCAGTCCCAGCAACTTACCTGGG + Intergenic
1192731335 X:73805286-73805308 TCAGTCTCAGCAACTTACCTGGG - Intergenic
1192913959 X:75634667-75634689 TCAGTCCCAGCAGCTTACCTGGG - Intergenic
1194135031 X:90130643-90130665 TGAGTACCTGCAGCTTTTCAAGG - Intergenic
1194426046 X:93739456-93739478 CCAGTTCCAGCAGCTAACAAAGG + Intergenic
1194522283 X:94933932-94933954 TCACTAGCAGCAGCTTTCTAGGG - Intergenic
1195451496 X:105018825-105018847 TCATTCCCAGCAAATTACCAAGG + Intronic
1197386658 X:125811376-125811398 TCAGTAACAGCCACTCACCAAGG - Intergenic
1200480814 Y:3700734-3700756 TGAGTACCTGCAGCTTTTCAAGG - Intergenic
1201937302 Y:19422298-19422320 TCAGTCCCAGCAACTTACCTAGG + Intergenic
1202076357 Y:21041468-21041490 TCAGTCCCAGCAGCTTACCTGGG - Intergenic