ID: 1044716283

View in Genome Browser
Species Human (GRCh38)
Location 8:95102669-95102691
Sequence TTCAGTACCAGCAGCTTACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 244
Summary {0: 1, 1: 1, 2: 61, 3: 35, 4: 146}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044716283_1044716288 19 Left 1044716283 8:95102669-95102691 CCTGGTAAGCTGCTGGTACTGAA 0: 1
1: 1
2: 61
3: 35
4: 146
Right 1044716288 8:95102711-95102733 GCTGTCAGTGTTGCAAGAGCTGG No data
1044716283_1044716286 -5 Left 1044716283 8:95102669-95102691 CCTGGTAAGCTGCTGGTACTGAA 0: 1
1: 1
2: 61
3: 35
4: 146
Right 1044716286 8:95102687-95102709 CTGAAGGAGCCAGGTGCTAGAGG No data
1044716283_1044716289 26 Left 1044716283 8:95102669-95102691 CCTGGTAAGCTGCTGGTACTGAA 0: 1
1: 1
2: 61
3: 35
4: 146
Right 1044716289 8:95102718-95102740 GTGTTGCAAGAGCTGGACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044716283 Original CRISPR TTCAGTACCAGCAGCTTACC AGG (reversed) Intronic
905441520 1:37999269-37999291 CTGAGTGCCAGCAGCTTATCGGG - Exonic
906491694 1:46273620-46273642 TCCAGGACCAGCATCTTACCTGG - Exonic
908458827 1:64329793-64329815 TTCAGTGCCTGAAGCTTTCCAGG - Intergenic
909729621 1:78875620-78875642 ATCAGTCCCAGCAGCTTACCTGG + Intergenic
911967104 1:104383515-104383537 ATCAGTCCCAGCAACTTTCCTGG + Intergenic
913245311 1:116865433-116865455 ATCAGTCCCAGCAGCTTACCTGG + Intergenic
914717257 1:150263341-150263363 TTCTGTACCAGAAGCTTAGAGGG - Exonic
915578337 1:156796676-156796698 GTAAGTGCCAGCAGCTTCCCTGG - Intronic
915612310 1:157004391-157004413 TGCTGTACCAGCAGATTTCCAGG + Intronic
916420235 1:164630934-164630956 ATCAGCTCCAGCAGCTTTCCAGG + Intronic
920618996 1:207525426-207525448 TGCAGCACTAGCAGCTTACAGGG - Intronic
920620777 1:207543982-207544004 TGCAGTATTAGCAGCTTACAGGG - Intronic
920622559 1:207562539-207562561 TGCAGTATTAGCAGCTTACAGGG - Intronic
920908187 1:210190604-210190626 ATCAGTCCCAGCAGCTTGCCTGG + Intergenic
922666175 1:227471331-227471353 TTCAGTGCCTGAAGCTTTCCAGG - Intergenic
923075395 1:230604547-230604569 AACAGTCCCAGCAGCTTACCTGG + Intergenic
1064022303 10:11819276-11819298 TTTAGTCCCAGCAGCTCACAAGG - Intergenic
1065596795 10:27320897-27320919 ATAAGTACCTGTAGCTTACCTGG + Intergenic
1069650434 10:70043203-70043225 TTCAGTACCAGCTGTGTCCCTGG + Intergenic
1070745064 10:78928682-78928704 TTCAGCTCCAGCAGCTTCCATGG - Intergenic
1071187418 10:83060475-83060497 TTCAGTCCCAGCAGTTTACCTGG + Intergenic
1073130764 10:101187757-101187779 ATCAGTCCCAGCAACTTACCTGG - Intergenic
1073394860 10:103209220-103209242 ATCAGTCTCAGCAACTTACCCGG + Intergenic
1074740966 10:116483978-116484000 ATCAGTCCCAGCAGCTTACCTGG + Intergenic
1074854899 10:117466355-117466377 TTCTATACCATCAGCTTCCCTGG + Intergenic
1076289081 10:129330315-129330337 AGCAGTACCAGTAGCTTTCCGGG - Intergenic
1078789173 11:14525787-14525809 ATCAGTCCCAGCAGCTTACCTGG + Intronic
1081159885 11:39737729-39737751 ATCGGTCCCAGCAGCTTACCTGG + Intergenic
1082191595 11:49251766-49251788 TTCATCACAAGCAGCTTACTTGG - Intergenic
1082268507 11:50144591-50144613 TTCACTAGAAGCAGCTTGCCTGG - Intergenic
1082287560 11:50333924-50333946 TTCACTAGAAGCAGCTTGCCTGG + Intergenic
1083180110 11:60979795-60979817 TTCAGTACCTGCTGAGTACCAGG + Intronic
1083708399 11:64532170-64532192 TTCAGCACCAACAGCTGACCTGG - Intergenic
1084354386 11:68627468-68627490 ATCAGTCCCAGCGGCTTACCTGG + Intergenic
1085312183 11:75523357-75523379 TTGAGTGCCAGCTGCATACCAGG - Intronic
1085570374 11:77553200-77553222 ATCAGTCTCAGCAACTTACCTGG + Intronic
1085627478 11:78084308-78084330 ATCAGTCCCAGCAACTTACCTGG + Intergenic
1086674529 11:89589252-89589274 TTCATCACAAGCAGCTTACTTGG + Intergenic
1089083448 11:115796963-115796985 TTCAGTACCAGCTGCTAGTCAGG - Intergenic
1089784298 11:120896820-120896842 GGCAGTAGCAGCAGCTTCCCTGG - Intronic
1089953493 11:122550277-122550299 ATCAGTCCCAGCAGCTTACCTGG + Intergenic
1092924669 12:13262349-13262371 ATCAGTGCCAGCAGCTTGCCTGG - Intergenic
1093302481 12:17473277-17473299 ATCAGTCTCAGCAACTTACCTGG + Intergenic
1093358612 12:18198285-18198307 ATCAGTACCAGCAGCTTACCTGG + Intronic
1094825924 12:34268957-34268979 ATCAGTCCCAGCAGCTTACCTGG + Intergenic
1095318665 12:40798249-40798271 TTCAGTAGCAACATCTCACCTGG - Intronic
1097592481 12:61589816-61589838 ATCAGTCCCAGAAGCTTACCTGG + Intergenic
1098146498 12:67503014-67503036 GGCAGTACCATTAGCTTACCAGG - Intergenic
1098920081 12:76294788-76294810 ATCAGTCCCAGCAGCTTACCTGG + Intergenic
1099872976 12:88371006-88371028 ATCAGTCCCAGCAGCTTACCTGG + Intergenic
1101960182 12:109243205-109243227 TTAAGTACCTGCTACTTACCAGG + Intronic
1102604665 12:114059171-114059193 ATCAGTCCCAGCAGCTTACCTGG + Intergenic
1104257799 12:127155124-127155146 ATCAGTCTCAGCAACTTACCTGG + Intergenic
1105032410 12:132893038-132893060 ATCGGTCCCAGCAGCTTACCTGG + Intronic
1107016911 13:35714802-35714824 AGCAGCACCAGCAGCTTCCCAGG + Intergenic
1108376883 13:49822306-49822328 TTCAGGACCATCATCTTTCCTGG + Intergenic
1108377214 13:49824730-49824752 TTCAGGACCATCATCTTTCCTGG - Intergenic
1109343760 13:61091687-61091709 ATCAGTCCCAGCAGCTTACCTGG + Intergenic
1111986529 13:95071696-95071718 TTCAGTACCAGAGGCCCACCTGG + Exonic
1116423355 14:44759976-44759998 AGCAGTACCACCAGCTTTCCTGG + Intergenic
1118529247 14:66684167-66684189 TTCAGTATCAGCAGCTCAAATGG - Intronic
1120659775 14:87237421-87237443 ATCAGTCCCAGCAGCTTACCTGG - Intergenic
1121193105 14:92047095-92047117 ATCAGTCCCAGCAGCTTACCTGG - Exonic
1121289611 14:92763197-92763219 ATCAGTCCCAGCAGCTTACCTGG + Intergenic
1124610553 15:31204916-31204938 TTGATTACCAGCAGCAGACCTGG - Intergenic
1125583079 15:40801170-40801192 TTCTGTAGCAGCCCCTTACCTGG - Intronic
1125629405 15:41134831-41134853 ATCAGTCTCAGCAGCTTACCTGG + Intergenic
1126843931 15:52741909-52741931 ATCAGTCCCAGCAGCTTACCTGG + Intergenic
1126875776 15:53039577-53039599 TACAATATCAGCAGCTTTCCAGG - Intergenic
1127530276 15:59836969-59836991 TTCAGTTTCAGCAGTCTACCTGG - Intergenic
1127844384 15:62856815-62856837 TTCATTTCCAGCCTCTTACCTGG + Intergenic
1129462712 15:75707908-75707930 CTCAGGACCAGCAGCTCCCCGGG - Intronic
1129722160 15:77883508-77883530 CTCAGGACCAGCAGCTCCCCGGG + Intergenic
1133766572 16:8842473-8842495 ATCAGTCCCAGCAGCTTACCTGG - Intronic
1136530111 16:30862379-30862401 ATCAGTCTCAGCAACTTACCTGG + Intronic
1137568553 16:49549605-49549627 TTCAGCAACAGCAGCTAACATGG + Intronic
1139470401 16:67175100-67175122 TTCAGCTCCAGCAGCATCCCAGG - Exonic
1143511720 17:7399783-7399805 TCCTGTAACAGCAGCTTTCCAGG + Intronic
1146069111 17:29662993-29663015 TTCAGTATCATCAGCTCTCCTGG - Intronic
1149418724 17:56487606-56487628 TTCAGTCCCAGCACAGTACCTGG - Intronic
1149590565 17:57826867-57826889 TTCAGAAGCAGCAGCTCAGCTGG + Intergenic
1150984616 17:70181793-70181815 TTCAGAAGCAGCAGCTTCCCAGG + Intergenic
1153881534 18:9425662-9425684 ATCAGTCCCAGCAGCTTACCTGG - Intergenic
1155176437 18:23305388-23305410 TTCAGTTCTAGCAGGTTACAGGG + Intronic
1156397806 18:36715072-36715094 TTCAGTTCCATCAGCTTTCCAGG - Intronic
1156915995 18:42464897-42464919 ATCAGTCCCAGCAGCTTACCTGG + Intergenic
1157200471 18:45654985-45655007 TTCATTACCTGCAGCTTCCACGG + Intronic
1157552602 18:48591867-48591889 TGCAGTACCAGCTGCTTAGGAGG - Intronic
1160812434 19:1018647-1018669 TTCTGTGCCACCAGATTACCGGG + Intronic
1161712302 19:5855748-5855770 ATCAGTCCCAGCAGCTTACCTGG + Intergenic
1162055406 19:8060661-8060683 GCCAGTACCCTCAGCTTACCAGG + Intronic
1162262399 19:9543566-9543588 GTCAGTCTCAGCAACTTACCTGG + Intergenic
1163497597 19:17655780-17655802 TTCAGCCCCAGCAACTTCCCAGG + Intronic
1163900030 19:20093001-20093023 ATCAGTCCCAGCAGCTTACCTGG - Intronic
1164003907 19:21132166-21132188 ATCAGTCCCAGCAGCTTACCTGG - Intergenic
1165437713 19:35805715-35805737 TTGTGTACCATCAGCTTAACTGG - Intronic
1166905602 19:46106435-46106457 ATCAGTCCCAGCAACTTACCTGG - Intergenic
1167901289 19:52624059-52624081 ATCAGTCCCAGCAGCTTACCTGG + Intronic
929383728 2:41381267-41381289 ATCAGTCCCAGCAACTTACCTGG + Intergenic
930098889 2:47588046-47588068 ATCAGTCCCAGCAGCTTACCTGG - Intergenic
930946467 2:57082972-57082994 TACACCACCAGCAGCTTCCCTGG - Intergenic
932028643 2:68160425-68160447 TTCAGTTCCAGTATCTTTCCGGG + Intronic
932143576 2:69299989-69300011 CTCAGGACCAGGAGCTTCCCTGG - Intergenic
932159270 2:69446034-69446056 ATCAGTCTCAGCAGCTTACCTGG - Intergenic
932367062 2:71160319-71160341 ATCAGTCCCAGCAGCTTACCTGG - Intergenic
937809835 2:126186963-126186985 TGCTGTGCCAGCAGCTTCCCAGG - Intergenic
937928640 2:127187770-127187792 TTCAGAACCAGCAGGAAACCCGG - Intronic
939848899 2:147280508-147280530 TTGAGTACCAGGTGCTTACTAGG - Intergenic
940183878 2:150961635-150961657 ATCAGTCCCAGCAACTTACCTGG + Intergenic
941204253 2:162551864-162551886 ACCAATACCAGCAGCTTGCCTGG - Intronic
941456014 2:165712882-165712904 ATCAGTCCCAGCAGCTTACCTGG - Intergenic
944251211 2:197581433-197581455 ATCAGTCCCAGCAGCTTACCTGG + Intronic
945173636 2:207020576-207020598 ATCAGTCCCAGCAGCTTACCTGG + Intergenic
945301307 2:208218617-208218639 ATCAGTCCCAGCAGCTTACCTGG - Intergenic
946349910 2:219143343-219143365 TTCAGTTCCAGCAGCTATACAGG + Intronic
1169180148 20:3557366-3557388 TTCAGTACCAGCAGTGTTCAAGG + Intronic
1169375744 20:5065616-5065638 CTCACTACCACCAGCTTCCCAGG + Intergenic
1170516557 20:17136311-17136333 TTCAGTACAAGTAGGTAACCAGG + Intergenic
1171231771 20:23492596-23492618 TTCAGAACCATCAGCTCTCCTGG - Intronic
1171336221 20:24388220-24388242 TGAAGACCCAGCAGCTTACCTGG + Intergenic
1172932285 20:38595093-38595115 ATCAGTCCCAGCAGCTTACCTGG - Intergenic
1173652226 20:44673688-44673710 ATCAGTCCCAGCAGCTTACCTGG + Intergenic
1173871408 20:46344307-46344329 TTCAGAACCAACAGCTTCCCAGG + Intergenic
1174149474 20:48476036-48476058 TGCAGTACCAGCTCCTTCCCGGG + Intergenic
1177100804 21:16895492-16895514 ATCAGTCCCAGCAGCTTACCTGG + Intergenic
1177529404 21:22340558-22340580 TTGAGTACCTGCAGCTTTTCTGG + Intergenic
1177781045 21:25622667-25622689 CTCAGAACCAGCAGCTTTCTGGG + Intergenic
1183045322 22:35214867-35214889 GTCAGTACCATCAGATTACCTGG - Intergenic
1183504389 22:38201325-38201347 CTCGGCACCATCAGCTTACCCGG - Intronic
1183635479 22:39059858-39059880 GTCAGTCCCAGCAGCTTACCTGG - Intronic
1183636642 22:39067664-39067686 ATCAGTCCCAGCAGCTTACCTGG - Intronic
1185099266 22:48828840-48828862 TTCAGTTCCACCAGGTAACCTGG - Intronic
949096558 3:93467-93489 TTCAATACAAGCAGTATACCAGG - Intergenic
951894792 3:27600477-27600499 ATCAGTCCCAGCAGCTTACCTGG + Intergenic
952297056 3:32070908-32070930 ATCAGTCCCAGCAGCTTACCTGG + Intronic
952895039 3:38073049-38073071 ATCAGTCCCAGCAGCTTACCTGG - Intronic
953413808 3:42704229-42704251 GTCAGTGCCAGGAGCTTACAGGG - Intronic
953599250 3:44347411-44347433 ATCAGTCTCAGCAACTTACCTGG - Intronic
953656375 3:44858063-44858085 ATCAGTCCCAGCAGCTTACCTGG - Intronic
953834313 3:46329884-46329906 ATCAGTCTCAGCAACTTACCTGG - Intergenic
955292028 3:57701030-57701052 TTCAGTACCAGTCCCTTGCCTGG + Intergenic
956756075 3:72388290-72388312 TGCAGTACCAGCAGCTGCCGTGG - Intronic
956855915 3:73274638-73274660 TTCAGTAGCATCAGCATCCCTGG + Intergenic
957456084 3:80448391-80448413 TTAAGTACCAGCATGTTAACAGG + Intergenic
957904675 3:86540765-86540787 ATCAGTTCCAGTAGCTTACCTGG - Intergenic
957985869 3:87572641-87572663 ATCAGTCTCAGCAACTTACCTGG + Intergenic
960583437 3:119299930-119299952 TTCCTTTCCAGCAGCTTGCCTGG + Intronic
961324203 3:126100490-126100512 GCCACTACCAGCAGCTCACCAGG - Intronic
961445915 3:126981649-126981671 TACACTCCCAGCAGCTTAGCAGG - Intergenic
962205755 3:133432446-133432468 ATCAGTCCCAGCAGCTTACCTGG + Intronic
962420718 3:135226308-135226330 TTCTGTCCCAGCAGCTGGCCTGG + Intronic
963319916 3:143800614-143800636 ATCAGTCCCAGCAGTTTACCTGG + Intronic
964984706 3:162724909-162724931 ATCAGTCCCAGCAGCTTACCTGG - Intergenic
965335279 3:167425921-167425943 ACCAGTCCCAGCAGCTTACCTGG + Intergenic
965624707 3:170674904-170674926 ATCAGCCCCAGCAGCTTACCTGG - Intronic
965639854 3:170820344-170820366 ATCAGTCCCAGCAGCTTACCTGG - Intronic
969653901 4:8485159-8485181 ATCAGTCCCAGCAGCTTACCTGG - Intronic
970617333 4:17780705-17780727 TTGAGTGCCAGCAGCTTGCGTGG - Intronic
971178757 4:24307693-24307715 TTCAGTACCAGCAGAGGATCTGG + Intergenic
974903957 4:68033942-68033964 ATCAGTCCCAGCAGCTTACCTGG + Intergenic
976739777 4:88346144-88346166 ATCAGTCTCAGCAACTTACCTGG - Intergenic
978543748 4:109848093-109848115 TTTAGTAACAGCAGATTACACGG - Intergenic
982318993 4:154059601-154059623 ATCAGTCCCAGTAGCTTACCTGG + Intergenic
982550221 4:156788452-156788474 TTCAGTATCAGAAACTTAGCAGG + Intronic
982727452 4:158920576-158920598 TGCAGTACCCTCAGCTTACTAGG + Intronic
989688742 5:44117104-44117126 ATCAGTCTCAGCAACTTACCTGG - Intergenic
991289275 5:65016645-65016667 TTCAGTAGCTGCTGCTCACCAGG - Intronic
992924494 5:81567667-81567689 TTGAGTATCTGCAGCTTTCCAGG - Intronic
992961009 5:81956583-81956605 ATCAGGCTCAGCAGCTTACCTGG + Intergenic
994325063 5:98437891-98437913 ATCAGTCTCAGCAACTTACCTGG + Intergenic
998578945 5:143349865-143349887 TTCAGTACCATCACCGCACCAGG - Intronic
1001294438 5:170489163-170489185 TTCAGTGCCTGCAGCCTCCCAGG - Intronic
1001354124 5:171003774-171003796 ATCAGTCCCAGTAGCTTACCTGG - Intronic
1003099921 6:3169192-3169214 ATCAGTCCCAGCAGCTTACCTGG + Intergenic
1007300801 6:40866591-40866613 ATCAGTCCCAGCAGCTTACCTGG - Intergenic
1007950030 6:45863527-45863549 TTCAGTACCAGAAGGTTCACTGG - Intergenic
1008052492 6:46914520-46914542 TTCAGTACTATCAGATTACAGGG + Intronic
1009464510 6:63953206-63953228 ATTAGTCCCAGCAGCTTACCTGG + Intronic
1014115172 6:117662102-117662124 ATCAGTCCCAGCAGCTTACCTGG - Intergenic
1017235379 6:152112722-152112744 GTCAGCACCAGCAGCTGACCTGG + Intronic
1017269977 6:152493435-152493457 ATCAGTCTCAGCAACTTACCTGG + Intronic
1018991789 6:168679362-168679384 ATCAGTCCCAGCAGCTTACCTGG - Intergenic
1019141736 6:169951450-169951472 TTCAGTAGCTGCAGCTACCCAGG - Intergenic
1020036095 7:4963896-4963918 TTCAAGACCAGCAGCATAGCGGG + Intergenic
1020794384 7:12662864-12662886 ATCAGTCCCAGCAGCTTACCTGG + Intergenic
1021637498 7:22706568-22706590 ATCAGTCCCAGCAGCTTACCTGG + Intergenic
1023586346 7:41734031-41734053 CTCAGTACCATCAGGTTCCCAGG + Intergenic
1023668063 7:42545944-42545966 TTCATTTTCAGCAGTTTACCTGG + Intergenic
1025236650 7:57239279-57239301 GTGAGTCCCAGCAGCTTCCCCGG - Intergenic
1025986297 7:66455533-66455555 TTCAATACCACCAGCCAACCTGG + Intergenic
1027158495 7:75785252-75785274 ATCAGTCCCCGCAGCTTACCAGG + Intronic
1028589717 7:92482169-92482191 ATCAGTCCCAGCAGCTTACCTGG - Intergenic
1029317348 7:99726595-99726617 ATCAGTCCCAGCAGCTTACCTGG + Intronic
1030192236 7:106821451-106821473 TTCAAAACTAGCAGCTTTCCAGG - Intergenic
1031422289 7:121566372-121566394 ATCAGTCCCAGCAGCTTACCTGG - Intergenic
1031904311 7:127444042-127444064 TTCAGTACCAACACCCTTCCTGG + Intergenic
1036525665 8:9532283-9532305 TTCAGTATCAGCATCCTTCCAGG + Intergenic
1036639662 8:10574593-10574615 ATCAGTCCCAGCAGCTTACCTGG + Intergenic
1038348973 8:26759290-26759312 TCCATTCCCAGCAGCTTATCTGG - Intronic
1039498822 8:38001064-38001086 ATCAGTCCCAGCAGCTTACCTGG - Intergenic
1040718621 8:50290057-50290079 TTCAGTGCCAGCAGGATTCCTGG + Intronic
1042991764 8:74648307-74648329 TGCAGTACCCTCAGCTTACTAGG + Intronic
1043256319 8:78142425-78142447 TTTAGTACTTGCAGCTTACATGG - Intergenic
1044634020 8:94304432-94304454 TTCAGCACCTGCAGTGTACCAGG + Intergenic
1044716283 8:95102669-95102691 TTCAGTACCAGCAGCTTACCAGG - Intronic
1045329272 8:101141550-101141572 TTCAGTAGCTGCAGCTTTCCAGG + Intergenic
1045506625 8:102783161-102783183 TGGAGAACCAGCAGCTGACCTGG + Intergenic
1046934833 8:119875626-119875648 ATCAGTCCCAGCAGCTTACCTGG - Intronic
1047422928 8:124722020-124722042 CTCAGCACCAGCAGCTTCCTGGG - Intronic
1047619743 8:126594202-126594224 TTTAATACCATCAGCTTTCCTGG - Intergenic
1048070863 8:131019456-131019478 TCCAGTACCAGCAGCTTAACAGG - Intronic
1049868646 8:144956646-144956668 ATCGGTCCCAGCAGCTTACCTGG - Intergenic
1050140657 9:2512764-2512786 ATCAGTCCCAGCAGCTTACCTGG + Intergenic
1051076876 9:13249457-13249479 TTCATTACCAGCACAGTACCAGG + Intronic
1051682598 9:19623039-19623061 TTCGCTTCCAGCAGATTACCAGG - Intronic
1052576471 9:30298736-30298758 TTCATTGCCATCAGCTTTCCTGG + Intergenic
1053269714 9:36741613-36741635 ATCAGTAGCAGCATCTAACCAGG - Intergenic
1053615562 9:39762017-39762039 CCCAGCACCAGCAGCTGACCAGG + Intergenic
1053873729 9:42521280-42521302 CCCAGCACCAGCAGCTGACCAGG + Intergenic
1053898893 9:42773267-42773289 CCCAGCACCAGCAGCTGACCAGG - Intergenic
1054237958 9:62580374-62580396 CCCAGCACCAGCAGCTGACCAGG - Intergenic
1054262624 9:62882951-62882973 CCCAGCACCAGCAGCTGACCAGG + Intergenic
1054268603 9:62945476-62945498 CCCAGCACCAGCAGCTGACCAGG - Intergenic
1054552089 9:66614884-66614906 CCCAGCACCAGCAGCTGACCAGG - Intergenic
1055334938 9:75224031-75224053 TTGAGTGCCTGCAGCTTTCCCGG + Intergenic
1056233199 9:84567676-84567698 TTAAGGACCAGCTGCCTACCTGG - Intergenic
1056406166 9:86277271-86277293 TCCTGTAACAGCAGCTTCCCAGG - Intronic
1057485019 9:95476015-95476037 TTCATCACCAGAAGCTCACCTGG + Exonic
1062692129 9:137847443-137847465 ATCGGTCCCAGCAGCTTACCTGG + Intronic
1185665910 X:1765428-1765450 TTCTGTACCACAAGCTTCCCAGG - Intergenic
1185880419 X:3735281-3735303 TTCAGTCCCAGCAGATCACCAGG + Intergenic
1187641956 X:21301297-21301319 TTCAGTGCCAGCACACTACCTGG - Intergenic
1188200780 X:27291522-27291544 ATCAGTCCCAGCAACTTACCTGG - Intergenic
1188300925 X:28505102-28505124 ATCAGTCCCAGCAGCTTACCTGG - Intergenic
1191761461 X:64652238-64652260 ATCAGTCCCAGCAGCTTACCTGG + Intergenic
1191805628 X:65132032-65132054 ATCAGTCCCAGCAGCTTACCTGG - Intergenic
1191825731 X:65363044-65363066 ATCAGTCCCAGCAACTTACCTGG + Intergenic
1192536061 X:71928708-71928730 TTCTGTACCATCTGCTTCCCTGG - Intergenic
1192731336 X:73805287-73805309 ATCAGTCTCAGCAACTTACCTGG - Intergenic
1192913960 X:75634668-75634690 ATCAGTCCCAGCAGCTTACCTGG - Intergenic
1195290979 X:103431915-103431937 TTCAGCCTCAGCAACTTACCTGG - Intergenic
1200084604 X:153597817-153597839 GTCAGTAACAGCACCTTATCTGG - Intronic
1200785369 Y:7256032-7256054 TTCAGTCCCAGCAGACCACCAGG - Intergenic
1202076358 Y:21041469-21041491 ATCAGTCCCAGCAGCTTACCTGG - Intergenic