ID: 1044716284

View in Genome Browser
Species Human (GRCh38)
Location 8:95102671-95102693
Sequence TGGTAAGCTGCTGGTACTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044716277_1044716284 3 Left 1044716277 8:95102645-95102667 CCCATGGGTACCTGAGGGAGGTG 0: 1
1: 0
2: 0
3: 11
4: 171
Right 1044716284 8:95102671-95102693 TGGTAAGCTGCTGGTACTGAAGG No data
1044716280_1044716284 -7 Left 1044716280 8:95102655-95102677 CCTGAGGGAGGTGCCCTGGTAAG 0: 1
1: 0
2: 0
3: 21
4: 182
Right 1044716284 8:95102671-95102693 TGGTAAGCTGCTGGTACTGAAGG No data
1044716278_1044716284 2 Left 1044716278 8:95102646-95102668 CCATGGGTACCTGAGGGAGGTGC 0: 1
1: 0
2: 1
3: 17
4: 218
Right 1044716284 8:95102671-95102693 TGGTAAGCTGCTGGTACTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044716284 Original CRISPR TGGTAAGCTGCTGGTACTGA AGG Intronic
No off target data available for this crispr