ID: 1044716286

View in Genome Browser
Species Human (GRCh38)
Location 8:95102687-95102709
Sequence CTGAAGGAGCCAGGTGCTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044716278_1044716286 18 Left 1044716278 8:95102646-95102668 CCATGGGTACCTGAGGGAGGTGC 0: 1
1: 0
2: 1
3: 17
4: 218
Right 1044716286 8:95102687-95102709 CTGAAGGAGCCAGGTGCTAGAGG No data
1044716282_1044716286 -4 Left 1044716282 8:95102668-95102690 CCCTGGTAAGCTGCTGGTACTGA 0: 1
1: 1
2: 62
3: 45
4: 166
Right 1044716286 8:95102687-95102709 CTGAAGGAGCCAGGTGCTAGAGG No data
1044716277_1044716286 19 Left 1044716277 8:95102645-95102667 CCCATGGGTACCTGAGGGAGGTG 0: 1
1: 0
2: 0
3: 11
4: 171
Right 1044716286 8:95102687-95102709 CTGAAGGAGCCAGGTGCTAGAGG No data
1044716280_1044716286 9 Left 1044716280 8:95102655-95102677 CCTGAGGGAGGTGCCCTGGTAAG 0: 1
1: 0
2: 0
3: 21
4: 182
Right 1044716286 8:95102687-95102709 CTGAAGGAGCCAGGTGCTAGAGG No data
1044716283_1044716286 -5 Left 1044716283 8:95102669-95102691 CCTGGTAAGCTGCTGGTACTGAA 0: 1
1: 1
2: 61
3: 35
4: 146
Right 1044716286 8:95102687-95102709 CTGAAGGAGCCAGGTGCTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044716286 Original CRISPR CTGAAGGAGCCAGGTGCTAG AGG Intronic
No off target data available for this crispr