ID: 1044719851

View in Genome Browser
Species Human (GRCh38)
Location 8:95134299-95134321
Sequence CCGTCCCCCCGCGGCGGCGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 355
Summary {0: 1, 1: 0, 2: 8, 3: 47, 4: 299}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044719851_1044719863 -2 Left 1044719851 8:95134299-95134321 CCGCCGCCGCCGCGGGGGGACGG 0: 1
1: 0
2: 8
3: 47
4: 299
Right 1044719863 8:95134320-95134342 GGGGGCCGCCGGGTAGGGTCCGG 0: 1
1: 0
2: 0
3: 19
4: 263
1044719851_1044719865 5 Left 1044719851 8:95134299-95134321 CCGCCGCCGCCGCGGGGGGACGG 0: 1
1: 0
2: 8
3: 47
4: 299
Right 1044719865 8:95134327-95134349 GCCGGGTAGGGTCCGGTCCACGG 0: 1
1: 0
2: 1
3: 6
4: 58
1044719851_1044719861 -8 Left 1044719851 8:95134299-95134321 CCGCCGCCGCCGCGGGGGGACGG 0: 1
1: 0
2: 8
3: 47
4: 299
Right 1044719861 8:95134314-95134336 GGGGACGGGGGCCGCCGGGTAGG 0: 1
1: 0
2: 5
3: 34
4: 401
1044719851_1044719867 6 Left 1044719851 8:95134299-95134321 CCGCCGCCGCCGCGGGGGGACGG 0: 1
1: 0
2: 8
3: 47
4: 299
Right 1044719867 8:95134328-95134350 CCGGGTAGGGTCCGGTCCACGGG 0: 1
1: 0
2: 2
3: 0
4: 45
1044719851_1044719873 19 Left 1044719851 8:95134299-95134321 CCGCCGCCGCCGCGGGGGGACGG 0: 1
1: 0
2: 8
3: 47
4: 299
Right 1044719873 8:95134341-95134363 GGTCCACGGGTCTGCGGGGCGGG No data
1044719851_1044719870 15 Left 1044719851 8:95134299-95134321 CCGCCGCCGCCGCGGGGGGACGG 0: 1
1: 0
2: 8
3: 47
4: 299
Right 1044719870 8:95134337-95134359 GTCCGGTCCACGGGTCTGCGGGG No data
1044719851_1044719874 20 Left 1044719851 8:95134299-95134321 CCGCCGCCGCCGCGGGGGGACGG 0: 1
1: 0
2: 8
3: 47
4: 299
Right 1044719874 8:95134342-95134364 GTCCACGGGTCTGCGGGGCGGGG No data
1044719851_1044719877 25 Left 1044719851 8:95134299-95134321 CCGCCGCCGCCGCGGGGGGACGG 0: 1
1: 0
2: 8
3: 47
4: 299
Right 1044719877 8:95134347-95134369 CGGGTCTGCGGGGCGGGGGCCGG No data
1044719851_1044719862 -7 Left 1044719851 8:95134299-95134321 CCGCCGCCGCCGCGGGGGGACGG 0: 1
1: 0
2: 8
3: 47
4: 299
Right 1044719862 8:95134315-95134337 GGGACGGGGGCCGCCGGGTAGGG 0: 1
1: 0
2: 1
3: 19
4: 222
1044719851_1044719869 14 Left 1044719851 8:95134299-95134321 CCGCCGCCGCCGCGGGGGGACGG 0: 1
1: 0
2: 8
3: 47
4: 299
Right 1044719869 8:95134336-95134358 GGTCCGGTCCACGGGTCTGCGGG No data
1044719851_1044719878 28 Left 1044719851 8:95134299-95134321 CCGCCGCCGCCGCGGGGGGACGG 0: 1
1: 0
2: 8
3: 47
4: 299
Right 1044719878 8:95134350-95134372 GTCTGCGGGGCGGGGGCCGGCGG No data
1044719851_1044719872 18 Left 1044719851 8:95134299-95134321 CCGCCGCCGCCGCGGGGGGACGG 0: 1
1: 0
2: 8
3: 47
4: 299
Right 1044719872 8:95134340-95134362 CGGTCCACGGGTCTGCGGGGCGG No data
1044719851_1044719875 21 Left 1044719851 8:95134299-95134321 CCGCCGCCGCCGCGGGGGGACGG 0: 1
1: 0
2: 8
3: 47
4: 299
Right 1044719875 8:95134343-95134365 TCCACGGGTCTGCGGGGCGGGGG No data
1044719851_1044719868 13 Left 1044719851 8:95134299-95134321 CCGCCGCCGCCGCGGGGGGACGG 0: 1
1: 0
2: 8
3: 47
4: 299
Right 1044719868 8:95134335-95134357 GGGTCCGGTCCACGGGTCTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044719851 Original CRISPR CCGTCCCCCCGCGGCGGCGG CGG (reversed) Intronic