ID: 1044719851

View in Genome Browser
Species Human (GRCh38)
Location 8:95134299-95134321
Sequence CCGTCCCCCCGCGGCGGCGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 355
Summary {0: 1, 1: 0, 2: 8, 3: 47, 4: 299}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044719851_1044719869 14 Left 1044719851 8:95134299-95134321 CCGCCGCCGCCGCGGGGGGACGG 0: 1
1: 0
2: 8
3: 47
4: 299
Right 1044719869 8:95134336-95134358 GGTCCGGTCCACGGGTCTGCGGG No data
1044719851_1044719873 19 Left 1044719851 8:95134299-95134321 CCGCCGCCGCCGCGGGGGGACGG 0: 1
1: 0
2: 8
3: 47
4: 299
Right 1044719873 8:95134341-95134363 GGTCCACGGGTCTGCGGGGCGGG No data
1044719851_1044719861 -8 Left 1044719851 8:95134299-95134321 CCGCCGCCGCCGCGGGGGGACGG 0: 1
1: 0
2: 8
3: 47
4: 299
Right 1044719861 8:95134314-95134336 GGGGACGGGGGCCGCCGGGTAGG 0: 1
1: 0
2: 5
3: 34
4: 401
1044719851_1044719862 -7 Left 1044719851 8:95134299-95134321 CCGCCGCCGCCGCGGGGGGACGG 0: 1
1: 0
2: 8
3: 47
4: 299
Right 1044719862 8:95134315-95134337 GGGACGGGGGCCGCCGGGTAGGG 0: 1
1: 0
2: 1
3: 19
4: 222
1044719851_1044719872 18 Left 1044719851 8:95134299-95134321 CCGCCGCCGCCGCGGGGGGACGG 0: 1
1: 0
2: 8
3: 47
4: 299
Right 1044719872 8:95134340-95134362 CGGTCCACGGGTCTGCGGGGCGG No data
1044719851_1044719877 25 Left 1044719851 8:95134299-95134321 CCGCCGCCGCCGCGGGGGGACGG 0: 1
1: 0
2: 8
3: 47
4: 299
Right 1044719877 8:95134347-95134369 CGGGTCTGCGGGGCGGGGGCCGG No data
1044719851_1044719868 13 Left 1044719851 8:95134299-95134321 CCGCCGCCGCCGCGGGGGGACGG 0: 1
1: 0
2: 8
3: 47
4: 299
Right 1044719868 8:95134335-95134357 GGGTCCGGTCCACGGGTCTGCGG No data
1044719851_1044719863 -2 Left 1044719851 8:95134299-95134321 CCGCCGCCGCCGCGGGGGGACGG 0: 1
1: 0
2: 8
3: 47
4: 299
Right 1044719863 8:95134320-95134342 GGGGGCCGCCGGGTAGGGTCCGG 0: 1
1: 0
2: 0
3: 19
4: 263
1044719851_1044719867 6 Left 1044719851 8:95134299-95134321 CCGCCGCCGCCGCGGGGGGACGG 0: 1
1: 0
2: 8
3: 47
4: 299
Right 1044719867 8:95134328-95134350 CCGGGTAGGGTCCGGTCCACGGG 0: 1
1: 0
2: 2
3: 0
4: 45
1044719851_1044719865 5 Left 1044719851 8:95134299-95134321 CCGCCGCCGCCGCGGGGGGACGG 0: 1
1: 0
2: 8
3: 47
4: 299
Right 1044719865 8:95134327-95134349 GCCGGGTAGGGTCCGGTCCACGG 0: 1
1: 0
2: 1
3: 6
4: 58
1044719851_1044719870 15 Left 1044719851 8:95134299-95134321 CCGCCGCCGCCGCGGGGGGACGG 0: 1
1: 0
2: 8
3: 47
4: 299
Right 1044719870 8:95134337-95134359 GTCCGGTCCACGGGTCTGCGGGG No data
1044719851_1044719874 20 Left 1044719851 8:95134299-95134321 CCGCCGCCGCCGCGGGGGGACGG 0: 1
1: 0
2: 8
3: 47
4: 299
Right 1044719874 8:95134342-95134364 GTCCACGGGTCTGCGGGGCGGGG No data
1044719851_1044719878 28 Left 1044719851 8:95134299-95134321 CCGCCGCCGCCGCGGGGGGACGG 0: 1
1: 0
2: 8
3: 47
4: 299
Right 1044719878 8:95134350-95134372 GTCTGCGGGGCGGGGGCCGGCGG No data
1044719851_1044719875 21 Left 1044719851 8:95134299-95134321 CCGCCGCCGCCGCGGGGGGACGG 0: 1
1: 0
2: 8
3: 47
4: 299
Right 1044719875 8:95134343-95134365 TCCACGGGTCTGCGGGGCGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044719851 Original CRISPR CCGTCCCCCCGCGGCGGCGG CGG (reversed) Intronic
900237611 1:1600158-1600180 CGGACCCGGCGCGGCGGCGGAGG + Intergenic
900970964 1:5992252-5992274 CCGACCCGCCGCGGCCGCGCCGG + Exonic
901086114 1:6613458-6613480 CCCTCCCCCCGCGGCCGAGCCGG + Intronic
901361365 1:8703429-8703451 CAGACTCCCCGCGACGGCGGCGG + Intronic
902142099 1:14365354-14365376 CCCTCCCCCCGGGGTGGGGGGGG + Intergenic
902823106 1:18955632-18955654 CCGTCCCAGGGCGGCGGGGGAGG + Intronic
903652329 1:24929792-24929814 GCCTTCCCCTGCGGCGGCGGCGG - Exonic
904181399 1:28668993-28669015 TCGCTCCCCGGCGGCGGCGGCGG - Intronic
904642010 1:31938134-31938156 CCGGCCCGGCCCGGCGGCGGCGG + Exonic
904746142 1:32712382-32712404 GCGGCCCCGCGCGGCTGCGGCGG - Intergenic
904822948 1:33256817-33256839 CCGGCCCAGAGCGGCGGCGGCGG + Intronic
905580899 1:39082030-39082052 CCGTTTCCCCACGGCGGAGGAGG - Intronic
906480954 1:46198477-46198499 CTCTCACCCCGCGGCAGCGGCGG - Intronic
906637012 1:47416485-47416507 CCGGCCCGGGGCGGCGGCGGCGG + Exonic
906960916 1:50419094-50419116 AGGCCCCCCGGCGGCGGCGGCGG + Exonic
907010632 1:50959896-50959918 TCGGCGCCCGGCGGCGGCGGCGG - Exonic
907053506 1:51345075-51345097 GCGGCCCCTCGCGGCGGCGGCGG + Exonic
907178890 1:52553021-52553043 CCGGCCTCCAGCGGCGGCAGCGG - Intronic
907364171 1:53945977-53945999 CCGCCCCCTCGCGGCGGCCTCGG + Intergenic
908534636 1:65066702-65066724 CGGAGTCCCCGCGGCGGCGGCGG - Intergenic
908556975 1:65265859-65265881 CCGTCTCCGCGCGGCGGTGCCGG + Intronic
912270158 1:108200346-108200368 CCGTCCCGCCGCTGCTGGGGAGG + Exonic
914808374 1:151008406-151008428 CCCGCCCCCAGCGGCGGAGGCGG - Intronic
915616892 1:157045938-157045960 CCCTCACGCCGCGGCGGCCGGGG + Intergenic
916824437 1:168430461-168430483 CCGTCCCTCCGCGGGGCCTGAGG - Intergenic
918388764 1:184037056-184037078 GCGTCCCGCCGCGGCGGCCCGGG + Intronic
922476705 1:225911530-225911552 CCGGCCGCCCGCGGCCGAGGAGG - Intronic
923612129 1:235504651-235504673 CCGTCACTCGGCGGCCGCGGGGG + Intergenic
1064208968 10:13347771-13347793 CCGGCCCCGCGCGGCGGCGGCGG + Intronic
1064645443 10:17454597-17454619 GTGACCCCGCGCGGCGGCGGCGG - Intergenic
1064712431 10:18140763-18140785 GCCTCCCACAGCGGCGGCGGCGG + Exonic
1066370459 10:34814997-34815019 GGGCCCGCCCGCGGCGGCGGCGG - Exonic
1067837296 10:49649558-49649580 CCGCCCCCCGGAGGCTGCGGTGG + Exonic
1067841032 10:49679668-49679690 CCTTGCCTCTGCGGCGGCGGAGG + Exonic
1068560960 10:58513454-58513476 CCGCTCCCCCGCGGAGCCGGAGG + Intronic
1069386114 10:67884757-67884779 CGGCTCCCCCTCGGCGGCGGGGG + Exonic
1070570647 10:77637748-77637770 CCCGCGCTCCGCGGCGGCGGCGG - Intronic
1070768405 10:79069233-79069255 GCGTCCTCCAGCGGCGGCAGCGG + Exonic
1070800838 10:79243565-79243587 CCGCGCCCCGGCGGCGGCGGCGG - Intronic
1070835639 10:79445486-79445508 CCGCCCCTCCGCTGCGGAGGGGG - Exonic
1072059739 10:91798475-91798497 CGGCTGCCCCGCGGCGGCGGAGG - Exonic
1072706922 10:97687441-97687463 CCGCCCCCGCGCGGCGCCCGAGG + Intergenic
1073196442 10:101695153-101695175 GCCTCCTCCCGGGGCGGCGGCGG - Exonic
1075802159 10:125160394-125160416 CCCACCCCACCCGGCGGCGGTGG + Intronic
1076373596 10:129969406-129969428 CCGTCGCCCCGCTGCGGGGCCGG - Intergenic
1077051317 11:568281-568303 CCGCCCTCCCGCGGGGGCTGCGG - Intergenic
1077419835 11:2444981-2445003 GCGGCCCCCCGCGGCGGGGCTGG + Exonic
1079689407 11:23403539-23403561 CCGTCCCGCGGCGGCGGCGGCGG - Intergenic
1080012496 11:27472560-27472582 CCGGCCCGGCGCAGCGGCGGGGG + Exonic
1081967176 11:47177067-47177089 CCGTCGCCCCGCCCCGGCTGCGG - Exonic
1082986079 11:59172356-59172378 GCGGACCCCGGCGGCGGCGGCGG + Intronic
1083562178 11:63681700-63681722 CCGTCCGCGCCCGGCGGCGGCGG + Exonic
1083617965 11:64035778-64035800 CTCTCCCCTCGCGGCGGCGGCGG - Intronic
1083886132 11:65574321-65574343 CCGTCCCGCCGGGGCGGGGCTGG + Intergenic
1083970310 11:66070411-66070433 GGCTTCCCCCGCGGCGGCGGCGG - Intronic
1084265513 11:68003509-68003531 ACGGCCCCCCGCGGCGGGGGTGG - Intronic
1084546845 11:69818944-69818966 CGCCCGCCCCGCGGCGGCGGCGG + Exonic
1084646795 11:70463625-70463647 CCGTCCTCACGCCGCAGCGGCGG - Intergenic
1084888120 11:72223828-72223850 CCGGCTCCCCGGGGCGGCGCGGG + Intronic
1085561269 11:77474206-77474228 CCTCCCCGGCGCGGCGGCGGCGG + Intronic
1086887835 11:92224973-92224995 CGAACCCCCGGCGGCGGCGGCGG + Intergenic
1087076217 11:94129095-94129117 CCGCCCCGCCCCGCCGGCGGCGG + Exonic
1088481069 11:110296709-110296731 GCGGCCCCCAGCGGCGGCGTTGG - Exonic
1089243126 11:117098433-117098455 CCGGCTCCCCGCGGCCCCGGAGG - Exonic
1091823643 12:3493538-3493560 CAGACCCCGCGCGGCAGCGGGGG - Intronic
1092564238 12:9648076-9648098 CCCGCCCCCCGGGGCTGCGGCGG + Intergenic
1095349048 12:41188347-41188369 CCGTCTCGCGGCGGCGGCAGTGG - Intergenic
1096250069 12:50025300-50025322 CCGGACCCCCGCGGCGGCCACGG + Intronic
1096461125 12:51821824-51821846 CCGTACCCCGGAGGCGGTGGGGG + Intergenic
1097264416 12:57737509-57737531 CCCTCCCCCGGCGGCGGCGGCGG + Exonic
1097267566 12:57755080-57755102 CCTTCCGGCGGCGGCGGCGGCGG - Exonic
1098255490 12:68611264-68611286 CTGTTCTCCCGCGGCGGCGGCGG - Intronic
1098426088 12:70366619-70366641 CTGTCGCGCGGCGGCGGCGGTGG + Exonic
1100444822 12:94650587-94650609 CCCCCACCCCGCGGCGGCGGCGG - Intergenic
1101935358 12:109052617-109052639 CGGTCCGGCGGCGGCGGCGGCGG + Exonic
1102136895 12:110583040-110583062 CCGCCCCCCCGAGGAGGCGGGGG + Exonic
1102853867 12:116277239-116277261 CCCTCCCCCGGCGGCGGCGGCGG - Exonic
1102853869 12:116277242-116277264 GCGCCCTCCCCCGGCGGCGGCGG - Exonic
1103364014 12:120369333-120369355 CCGGGCGCCCGCGGAGGCGGCGG + Intergenic
1106517014 13:30464933-30464955 CCCTCCCCCCGCCGCGGTGGGGG + Intronic
1107851388 13:44576467-44576489 CCCTCCTCCCGCCGCGTCGGCGG + Exonic
1112344357 13:98577311-98577333 CCGCCCGCCCGCGGGGGCGTGGG - Intronic
1112507196 13:99982130-99982152 CCACTCCGCCGCGGCGGCGGCGG + Exonic
1114485166 14:23057650-23057672 CCGGGCCCGCGCGGCGGGGGCGG + Intergenic
1114612520 14:24052097-24052119 CGGCTCCCCGGCGGCGGCGGCGG + Exonic
1115474484 14:33800381-33800403 CCGTCCCCGCAGGGCGGCGGCGG + Exonic
1115651162 14:35403977-35403999 CCCTCCCCCCGCGGCCCCGGCGG + Intronic
1115761312 14:36581062-36581084 CCGTGCGGCGGCGGCGGCGGTGG - Exonic
1116657923 14:47674736-47674758 CTGTCCTTCCCCGGCGGCGGCGG + Exonic
1116905089 14:50396635-50396657 CCGGCTCCCCGCGGAGGCGGCGG + Intronic
1118351005 14:64972377-64972399 CCCTCTCTCCGGGGCGGCGGCGG - Intronic
1119743208 14:77027292-77027314 CTGTTCCACCGCAGCGGCGGCGG + Exonic
1120168029 14:81220939-81220961 CTGTCTCTCGGCGGCGGCGGCGG - Intronic
1122183353 14:99971503-99971525 CCCTCCGCCCGCGGCCGCTGAGG - Intronic
1122231200 14:100306976-100306998 CTGCGCGCCCGCGGCGGCGGTGG + Intergenic
1122445011 14:101761773-101761795 CAGTCCCCGGGCGGCGGCGGCGG + Intergenic
1122544977 14:102517158-102517180 CCCTCGCCCCGCGGCCTCGGCGG + Intergenic
1122736521 14:103847047-103847069 GCTTCTCCCCGCGGCCGCGGAGG + Intronic
1123024877 14:105419858-105419880 CCGTCCCTGCGCGGCCTCGGCGG + Exonic
1123048470 14:105529717-105529739 CCGTGCAGCGGCGGCGGCGGCGG - Exonic
1124109484 15:26773051-26773073 CCGGGCCAGCGCGGCGGCGGCGG - Exonic
1125508787 15:40282026-40282048 CCGGGCCGCAGCGGCGGCGGCGG + Exonic
1125509026 15:40282992-40283014 CCGCTCCCCCGCAGCGACGGTGG + Intronic
1129199873 15:73992329-73992351 GCGGCCACCCGCGGCGGCGCGGG + Exonic
1132255573 15:100373479-100373501 CCGGCCAGGCGCGGCGGCGGCGG + Intergenic
1132604592 16:788433-788455 CCGCCCTTCCGCGGCGGGGGCGG - Intergenic
1132629395 16:909714-909736 CTGTCCCCCCGGGGCAGCTGCGG - Intronic
1132641874 16:981775-981797 CCGAGCCTCGGCGGCGGCGGCGG + Intergenic
1132877962 16:2148669-2148691 CCTTCCCCTGGCGGCGGCGGCGG - Exonic
1133156584 16:3880508-3880530 CCGGAGCCCGGCGGCGGCGGCGG - Exonic
1134163959 16:11915578-11915600 CCGGGCCCTTGCGGCGGCGGCGG - Exonic
1135040605 16:19114438-19114460 CCGGGCGCCCGGGGCGGCGGTGG - Exonic
1135821885 16:25692387-25692409 CCGGCTCGCGGCGGCGGCGGCGG - Exonic
1136556498 16:31010501-31010523 CAGGCCCCCCGCAGCGGCCGCGG - Exonic
1137412927 16:48244630-48244652 GGCTGCCCCCGCGGCGGCGGCGG + Intronic
1137454779 16:48609980-48610002 GCGGCCTCCCGCGGCGGCGCCGG + Exonic
1138360749 16:56425441-56425463 CCGGCCCGGCGCGGCGGCGGCGG - Exonic
1139570251 16:67807041-67807063 AGGCCCCCCCGCGGCGGGGGCGG - Intronic
1141582726 16:85011325-85011347 CCGGCCTGCGGCGGCGGCGGCGG + Exonic
1141704553 16:85657554-85657576 CCGGCCCCCGGTGCCGGCGGAGG + Exonic
1142136282 16:88453352-88453374 CCGAGCGGCCGCGGCGGCGGCGG + Exonic
1142474591 17:181452-181474 CCTTCTCCCCGCGCCGCCGGAGG + Exonic
1143390497 17:6556624-6556646 CAGTCCCTCCCCGGCGGCGCGGG - Intergenic
1143448808 17:7023679-7023701 CGCTCCCTCCGGGGCGGCGGGGG - Exonic
1144109803 17:12020896-12020918 CCGAGCCCGAGCGGCGGCGGCGG + Exonic
1144784433 17:17823819-17823841 CCACCTCCCCACGGCGGCGGGGG + Intronic
1144816621 17:18039647-18039669 CGGCTCCCGCGCGGCGGCGGCGG + Exonic
1144910061 17:18673043-18673065 GCTTCCCCAGGCGGCGGCGGCGG - Exonic
1145765515 17:27456268-27456290 CCCTCCCCTCCCGGCGGCCGCGG - Intergenic
1146034060 17:29390719-29390741 CGGTTCCCCCGAGGCGGCGACGG + Exonic
1146058656 17:29593414-29593436 GCGTCCTCGCGAGGCGGCGGCGG - Intronic
1146183106 17:30709538-30709560 CGGCCCCCTCGCGGCGGCGGAGG - Intergenic
1147150265 17:38510183-38510205 CAGTCCCCCGGCGGCGCCGGAGG + Exonic
1147150369 17:38510561-38510583 GCGGCCCCCGGCGGCGGCGCTGG + Exonic
1147193226 17:38748903-38748925 CCTTGCCCCCTCGGCGGCAGGGG + Intronic
1147793009 17:43025128-43025150 CCGCCCCCCGGCTGCGGGGGTGG + Intergenic
1147967139 17:44199540-44199562 GCGTCCTCCGGCGGCGGCGACGG + Intronic
1148262166 17:46193277-46193299 TCGTCTCGCCGCGGCGGCGCGGG - Intronic
1148698629 17:49575658-49575680 CCTCCCACCGGCGGCGGCGGCGG - Intergenic
1152729124 17:81961259-81961281 CCGAGCCCGGGCGGCGGCGGCGG - Exonic
1153794395 18:8609479-8609501 TCCTCTCCCGGCGGCGGCGGCGG + Exonic
1154304085 18:13218067-13218089 CCGCCCCCCCGGAGCGGAGGCGG - Intronic
1155096374 18:22559813-22559835 CCGGACGCCCGCGGGGGCGGGGG + Intergenic
1155928812 18:31685101-31685123 CCGGCGCCCCGCGGCCGCCGCGG + Intronic
1158954163 18:62523605-62523627 CCGAGTCCCCGGGGCGGCGGCGG - Exonic
1160453338 18:78979741-78979763 CCGCCCGGCGGCGGCGGCGGGGG + Intergenic
1160706304 19:531779-531801 GGGTCCCCGGGCGGCGGCGGCGG + Exonic
1160719130 19:589891-589913 CCGGCCGGCGGCGGCGGCGGCGG + Exonic
1161267351 19:3370387-3370409 CCCTCCCCTCTCTGCGGCGGAGG + Intronic
1161400702 19:4065457-4065479 CCCGGCCCCGGCGGCGGCGGTGG + Intronic
1161802675 19:6424637-6424659 CCGCCCGCCGGCGGGGGCGGGGG - Exonic
1162033201 19:7926044-7926066 CCTCTCCCCGGCGGCGGCGGCGG + Exonic
1162604211 19:11694585-11694607 CCGTCCCTTCGCGGCGACTGCGG - Intergenic
1162615750 19:11798929-11798951 CCGTCCCTACGCGGCGACTGCGG + Intronic
1162630808 19:11925471-11925493 CCGTCCCTGCGCGGCGACTGCGG + Intronic
1162705328 19:12551111-12551133 CCGTCCCTGCGCGGCGACTGCGG - Intronic
1162713182 19:12611204-12611226 CCGTCCCTGCGCGGCGACTGCGG + Intronic
1162975688 19:14206230-14206252 CGGCCCCCTCGCGGCGGCGGAGG + Intergenic
1163154471 19:15432487-15432509 CCGTCCCGCGGCGGCGGTGGCGG + Intronic
1163162341 19:15472062-15472084 CCGCTCCCCAGCGGCAGCGGGGG + Exonic
1163606975 19:18280978-18281000 GGGCCCCCCGGCGGCGGCGGCGG + Exonic
1163635066 19:18433835-18433857 CTCCCCCCCCGCGGCGGCGTCGG + Intronic
1163743894 19:19033492-19033514 CCCGCCTCGCGCGGCGGCGGCGG - Intronic
1165213662 19:34254516-34254538 GCGTCCGCCCGAGGCGGGGGCGG + Exonic
1165419985 19:35717883-35717905 CCGGTCTCCCGCGGCGGCGCTGG + Intergenic
1166361256 19:42253873-42253895 CCTTCCCCCGGCGGCGGCGGCGG - Intronic
1166894665 19:46016076-46016098 CGGTCCTCCCGCGTCGGGGGCGG - Exonic
925389135 2:3483652-3483674 ACGTCCCCCCCCGGCAGTGGAGG + Intronic
926066297 2:9843211-9843233 CCGACCCCCCGTGCCGCCGGAGG + Intergenic
926217097 2:10912352-10912374 CGGACCCCCAGCGGCAGCGGCGG + Exonic
927472275 2:23385407-23385429 CCCTCTCCCCGCAGCCGCGGCGG - Exonic
927652295 2:24920043-24920065 CCCTGCACCCGCGGCGGCGGCGG + Intergenic
928983220 2:37156922-37156944 CCGGCCGGCGGCGGCGGCGGCGG - Exonic
931252881 2:60549691-60549713 CCGTCACCCCGCGGCCGAGCTGG - Intronic
933666863 2:84971288-84971310 CGCTCCCGCGGCGGCGGCGGCGG - Exonic
933741636 2:85538763-85538785 GCGTCCCCCAGCGGAGGCGGCGG - Intergenic
935592733 2:104856222-104856244 CCGGGGCCCGGCGGCGGCGGCGG + Exonic
935592780 2:104856384-104856406 CCGCACCACGGCGGCGGCGGCGG + Exonic
936433187 2:112482015-112482037 CCCTCCCCCGGGGGCGGCGGCGG - Intergenic
938796021 2:134718862-134718884 GCGTGGCCCCGGGGCGGCGGCGG + Exonic
940830067 2:158457036-158457058 ACCACCCCCGGCGGCGGCGGTGG - Intronic
940830069 2:158457039-158457061 CCCACCACCCCCGGCGGCGGCGG - Intronic
942241111 2:173964677-173964699 CCGCCCCCCGGCGGCGGCGGCGG + Intronic
942279057 2:174342680-174342702 CCCTGCGCCCGAGGCGGCGGAGG + Intergenic
942346116 2:175004861-175004883 CCGTCTCCCCGCGCCGCCGCAGG - Intronic
942450897 2:176107575-176107597 CCGTACCGCGGCGGCGGCGGCGG + Exonic
943571509 2:189580776-189580798 CCGGCCCACGGCGGCGGCGGCGG - Exonic
943725326 2:191246087-191246109 GTGTGCCCCGGCGGCGGCGGGGG + Intronic
944412669 2:199458586-199458608 TCGTCCCGGCGCGGAGGCGGCGG + Intronic
944451808 2:199851146-199851168 CGGGCCACGCGCGGCGGCGGAGG - Intronic
944831214 2:203535334-203535356 GCAGCGCCCCGCGGCGGCGGCGG + Exonic
944831215 2:203535337-203535359 GCGCCCCGCGGCGGCGGCGGCGG + Exonic
946248570 2:218400239-218400261 GCGGCCGCCCGGGGCGGCGGCGG - Intronic
947506660 2:230713058-230713080 ACGGGCTCCCGCGGCGGCGGCGG - Exonic
948046889 2:234951991-234952013 CCCTCCGCCCGCCGAGGCGGGGG + Intronic
948689045 2:239690707-239690729 CCGCCCCCCCGGGACGCCGGGGG - Intergenic
1168753127 20:297755-297777 TCCTCCCGCCGCGGCGGCCGCGG - Exonic
1169214730 20:3786515-3786537 CCGCCCCGGGGCGGCGGCGGCGG - Exonic
1169214734 20:3786518-3786540 CCCCCGCCCCGGGGCGGCGGCGG - Exonic
1170756919 20:19212881-19212903 CCCTCCGGCGGCGGCGGCGGCGG - Exonic
1174287766 20:49484190-49484212 TCCTGCTCCCGCGGCGGCGGCGG + Intergenic
1175962099 20:62642437-62642459 CCCTCCCTCTGCGGCGGGGGCGG + Exonic
1176547075 21:8206706-8206728 GCGGCCCCCCTCCGCGGCGGTGG + Intergenic
1176554980 21:8250915-8250937 GCGGCCCCCCTCCGCGGCGGTGG + Intergenic
1176566026 21:8389753-8389775 GCGGCCCCCCTCCGCGGCGGTGG + Intergenic
1176573902 21:8433939-8433961 GCGGCCCCCCTCCGCGGCGGTGG + Intergenic
1177011059 21:15730374-15730396 CATGGCCCCCGCGGCGGCGGCGG - Exonic
1178513830 21:33229897-33229919 CCCCGCCCCCGCGCCGGCGGCGG + Intronic
1179561597 21:42219244-42219266 CCATGCCCCGGGGGCGGCGGCGG - Exonic
1179674989 21:42974970-42974992 CAGGCCCAGCGCGGCGGCGGCGG - Intronic
1180649958 22:17369510-17369532 CCATCCCGCGGCTGCGGCGGCGG - Exonic
1181006740 22:20017029-20017051 CCGAACCTCTGCGGCGGCGGTGG + Intronic
1181169906 22:21002173-21002195 CCGCCCCGCCCCGGTGGCGGGGG - Intronic
1184673374 22:46027432-46027454 CTGTCCCCACGCGGCGCCGCGGG - Intergenic
1185055262 22:48575860-48575882 CTGGCCCGCCGCGGCGGCGGTGG + Intronic
1185279145 22:49962484-49962506 CCGTCCCCCTCCGCCGGCCGCGG - Intronic
1185316173 22:50180139-50180161 CGGGCCCCCCGCCGCGGCTGAGG + Exonic
1203251950 22_KI270733v1_random:122991-123013 GCGGCCCCCCTCCGCGGCGGTGG + Intergenic
1203260003 22_KI270733v1_random:168073-168095 GCGGCCCCCCTCCGCGGCGGTGG + Intergenic
949779689 3:7672069-7672091 CCCTCCCCCCGGGGCAGGGGAGG - Intronic
949970246 3:9397677-9397699 CCCTCCCCCGGCAGCGGCGGCGG - Intronic
953027529 3:39153560-39153582 GCGTCCGGCAGCGGCGGCGGCGG + Exonic
953947769 3:47164003-47164025 AGGTCCGACCGCGGCGGCGGCGG + Intergenic
954615552 3:51967336-51967358 CTGTCCTGCGGCGGCGGCGGCGG + Exonic
955911576 3:63863963-63863985 GGGTCCCGCGGCGGCGGCGGCGG - Intergenic
958641509 3:96813424-96813446 ACCTCGCCCCGCGGCGGAGGCGG - Intergenic
959530732 3:107431540-107431562 CCGAGCCCCGGCGGCGGCGGCGG - Intergenic
959591897 3:108090931-108090953 CCGGACACCTGCGGCGGCGGCGG - Exonic
962498637 3:135966504-135966526 ACGCCCCTCCGCGGCGGCGGCGG - Intronic
963904458 3:150762662-150762684 TCGGGCCCCGGCGGCGGCGGCGG - Exonic
965590774 3:170358135-170358157 CCGTCAGCCCCCGGCGGCGCAGG + Intronic
965590829 3:170358308-170358330 CCGCCCCCCCGCGGGGGCCGCGG - Intronic
965757415 3:172040309-172040331 CCGCCTCTCCGCGCCGGCGGGGG + Intronic
966860965 3:184230646-184230668 CCGTCCACCGGCTGCGGCTGCGG - Exonic
968225616 3:196970121-196970143 CCGACCCTCGGCGGCGGCGCGGG - Intergenic
968575069 4:1362227-1362249 CCGCCTCCCCGCGGTGGCTGGGG + Intronic
968659595 4:1793605-1793627 CCCTCCCAGGGCGGCGGCGGCGG - Intronic
968701302 4:2059405-2059427 CGGACCCGCGGCGGCGGCGGCGG - Intergenic
970195210 4:13544906-13544928 CCCACCCCCGGCGGCGGCGGCGG + Exonic
970202882 4:13627490-13627512 CCGGGGCCCGGCGGCGGCGGCGG + Exonic
971327428 4:25655732-25655754 CAGTGCCCCGGCGGCGGCTGCGG + Intronic
975342573 4:73258566-73258588 GGGCCCCCCCGCGGCGGCGGAGG - Exonic
979231504 4:118352909-118352931 CTGTCCCCTGGCGGCGGCCGCGG + Exonic
980053643 4:128060992-128061014 GCCTGCCCCCGCGGCGACGGCGG - Intergenic
980130063 4:128809966-128809988 CGGTCCCGCGGCGGCGACGGCGG + Intronic
981782630 4:148444766-148444788 CCGCCCGCCCCCAGCGGCGGCGG + Intergenic
981782825 4:148445364-148445386 GCGCCCCCCCACGGCGGGGGTGG - Intergenic
982712208 4:158768947-158768969 CAGCCCCACGGCGGCGGCGGCGG - Intergenic
982712209 4:158768950-158768972 CCGCAGCCCCACGGCGGCGGCGG - Intergenic
984462992 4:180059159-180059181 GCGCCCGGCCGCGGCGGCGGCGG + Intergenic
984917014 4:184734042-184734064 CCATGGCCCCGCGGGGGCGGCGG - Exonic
985696700 5:1344959-1344981 TCGTTCCCCCGCGGCGGTGGCGG - Exonic
986695927 5:10354107-10354129 CCCGCCCCCCTCGGCGGCGCGGG - Intronic
989011368 5:36876558-36876580 CCGTCCCCTCAGGGCGGCTGTGG - Intergenic
989379270 5:40797897-40797919 CCGCAGCCCCGCGGCGGCTGGGG + Intronic
989576456 5:42992658-42992680 GCGTTCCCGGGCGGCGGCGGCGG + Intergenic
989584784 5:43066375-43066397 CAGTCCCCCGGCGGCGCCGCTGG - Intronic
990955151 5:61332811-61332833 CCCGGCCCCCGCGGCGGCGGCGG - Exonic
992105785 5:73448201-73448223 CTGTCCCCGCGCAGCGGCGGCGG - Exonic
992561635 5:77958149-77958171 CCGTCAGCCCGAGGCGGCGCTGG + Intergenic
993900504 5:93581268-93581290 CCCACCCCCGGCGGCGGCAGCGG + Intergenic
993901216 5:93585105-93585127 CAGGCGGCCCGCGGCGGCGGCGG + Exonic
993901217 5:93585108-93585130 GCGGCCCGCGGCGGCGGCGGCGG + Exonic
995106247 5:108381036-108381058 CAGCCCCGCTGCGGCGGCGGGGG - Exonic
995650412 5:114362364-114362386 CGGTGCCCCGGCGGCGGGGGCGG + Exonic
997013384 5:129904566-129904588 ACTTCTCCCGGCGGCGGCGGTGG - Exonic
997319159 5:132963578-132963600 CCGTCCGCTGGCGGCGGCGACGG + Exonic
998236402 5:140402058-140402080 CCGACCCCTCCCGGCGGAGGCGG - Exonic
1000220188 5:159208228-159208250 TCTTAGCCCCGCGGCGGCGGCGG - Intronic
1000319024 5:160119156-160119178 AGCTCCCCCGGCGGCGGCGGTGG + Exonic
1002029305 5:176416303-176416325 CGGTGCCCCGGAGGCGGCGGAGG - Exonic
1002055811 5:176597400-176597422 GCGTCCTCGCGCGGCGGCGGCGG + Exonic
1003948102 6:11093768-11093790 CCGACCCCGCGCCGCGGAGGAGG + Intergenic
1004044693 6:12012453-12012475 CGACCCCCGCGCGGCGGCGGCGG - Exonic
1004924531 6:20403858-20403880 CGGTGCCCCCGCGGCGTCGGCGG - Intronic
1012399993 6:98835066-98835088 CTGTCCCACGGCGGCGGCGGCGG + Exonic
1013273253 6:108561076-108561098 GCTTCCCCAGGCGGCGGCGGCGG + Exonic
1013514848 6:110875763-110875785 CCTCCCACCCGCGGCGGCCGCGG + Intronic
1015149337 6:130020213-130020235 CCGTCCTCGCGCCGCGGCGGCGG + Intronic
1017672493 6:156779560-156779582 CCGTCTTCCCGCGGGGGCGGCGG + Intronic
1018686283 6:166307297-166307319 CCGGCCCCGCGCGGCAGCCGCGG + Exonic
1018792242 6:167157525-167157547 CCATCCCCACGCTGCGGCTGAGG + Exonic
1018876603 6:167827097-167827119 CCGGCCCCGCGCGGCTGAGGAGG + Exonic
1019474250 7:1236436-1236458 CAGCCCCGCGGCGGCGGCGGCGG - Exonic
1020383090 7:7567116-7567138 CCGGCCCCTCGCTGCGGCCGCGG - Intronic
1021231097 7:18086894-18086916 CCCCCCCCGCGCGGCGGCGGCGG + Intergenic
1021600221 7:22356985-22357007 CCTGGCCGCCGCGGCGGCGGTGG - Intronic
1021668614 7:23013492-23013514 CCGTCCCCTCCCTGCCGCGGCGG - Intronic
1025069677 7:55887591-55887613 CGGGTCCACCGCGGCGGCGGCGG + Intronic
1026013603 7:66655121-66655143 CTGTCCCCCCAGGGCGACGGGGG - Intronic
1026765270 7:73155761-73155783 CCCTCCCCCCGCCGTGGCGACGG - Intergenic
1026909472 7:74083901-74083923 CCGCCTCCCCGGGCCGGCGGCGG + Intronic
1027041744 7:74965517-74965539 CCCTCCCCCCGCCGTGGCGACGG - Intronic
1027081898 7:75236852-75236874 CCCTCCCCCCGCCGTGGCGACGG + Intergenic
1028585593 7:92447989-92448011 CCGGCCCCTCCCGCCGGCGGAGG + Intronic
1028621488 7:92833570-92833592 CGCTCCTCCGGCGGCGGCGGCGG - Exonic
1029640535 7:101816749-101816771 GCGGCCACCGGCGGCGGCGGCGG + Intronic
1031051884 7:116953441-116953463 CCGGGCCGCGGCGGCGGCGGCGG + Exonic
1031604143 7:123748691-123748713 GTGACCCTCCGCGGCGGCGGCGG + Exonic
1031604227 7:123749029-123749051 CCCTCCCGCAGCGGCGGCGGCGG + Exonic
1032074572 7:128830342-128830364 CCGCCCCCCCGCCGCGCCCGCGG - Intergenic
1032279760 7:130491388-130491410 CCTGCCCCGCGCAGCGGCGGTGG + Intronic
1034174747 7:149091261-149091283 CCGTCCCGCCGGGGGCGCGGAGG + Intergenic
1034179584 7:149126790-149126812 CCGTCCCGCCGGGGGCGCGGAGG + Intronic
1034342768 7:150368841-150368863 CCGCCCCGCCGCGGCGACAGCGG - Exonic
1034902201 7:154914623-154914645 CCGTCCCCCCGGGGGGCCTGGGG + Intergenic
1035016305 7:155769433-155769455 CCGTCCCCCAGAGGCTGCTGAGG + Intronic
1035169535 7:157009940-157009962 CAGGCCCCCAGCGGCGGCGGCGG + Exonic
1035581043 8:739000-739022 CCATTCACCGGCGGCGGCGGCGG - Intergenic
1036723694 8:11200969-11200991 CGCTCCACCTGCGGCGGCGGCGG + Exonic
1037819908 8:22130577-22130599 TCCTTCCCCCGGGGCGGCGGGGG + Exonic
1038632925 8:29262896-29262918 CGGACCCCCCACGGCGGCCGAGG + Intronic
1039512819 8:38105363-38105385 CCGGCCTCCCGCGCCGGCGGTGG - Exonic
1043502809 8:80873845-80873867 CCGGCGCTGCGCGGCGGCGGCGG + Intronic
1044719851 8:95134299-95134321 CCGTCCCCCCGCGGCGGCGGCGG - Intronic
1044832304 8:96262007-96262029 CCGTCCTGCCGCGGTGGCGGCGG - Exonic
1047202857 8:122781341-122781363 ACGACCCCGCGCGGCGGCCGCGG - Intergenic
1048214264 8:132480863-132480885 CCGGCGCTCCGGGGCGGCGGCGG + Exonic
1049585304 8:143430168-143430190 CCGGGCACCGGCGGCGGCGGCGG - Exonic
1049762172 8:144336605-144336627 CCCCCCCCCCGCCGCCGCGGCGG + Intergenic
1049784653 8:144444569-144444591 CCGCCCCTCGACGGCGGCGGCGG + Intergenic
1052301384 9:26956495-26956517 CCCTCCTTCCGCGCCGGCGGAGG + Intronic
1052362216 9:27573450-27573472 GCCTGCGCCCGCGGCGGCGGAGG - Intronic
1053011794 9:34637796-34637818 CCGTACCACGGCGGTGGCGGGGG - Intronic
1053114615 9:35490131-35490153 TCGTCCTTCCGCGCCGGCGGCGG - Intronic
1053153465 9:35757213-35757235 CCCTCTCCCTCCGGCGGCGGGGG - Exonic
1054541681 9:66270026-66270048 CCATCCCCCGGCGACGGTGGCGG - Intergenic
1054781996 9:69174202-69174224 CCCTCCTCCCGCGGCGGCGGCGG - Intronic
1054835652 9:69672546-69672568 CCGCGAGCCCGCGGCGGCGGCGG + Intergenic
1057533485 9:95875729-95875751 CTGTCCTCCTCCGGCGGCGGCGG + Exonic
1057922153 9:99105685-99105707 CCGTGCCCAGGGGGCGGCGGCGG - Intronic
1058467567 9:105244664-105244686 ACATCCCCCGGCGGCGGCGACGG - Exonic
1059314277 9:113410662-113410684 CCGTCACCCAGCAGCGGCGCAGG - Exonic
1059633940 9:116154350-116154372 CCGCCCGGCGGCGGCGGCGGCGG - Exonic
1059769831 9:117414790-117414812 CCGGCCAGCAGCGGCGGCGGCGG + Exonic
1061038734 9:128127725-128127747 GCGCCCGCCCGCGGCGCCGGCGG - Exonic
1061542121 9:131283070-131283092 CCGTCCTTCCCCGGCGGCGGGGG - Intergenic
1061559675 9:131394348-131394370 CGGGCCCCCGGCGGCGGCCGCGG - Intronic
1062630777 9:137462149-137462171 CCGGCCACCCGCGGCGGCGGAGG - Intronic
1203468353 Un_GL000220v1:106141-106163 GCGGCCCCCCTCCGCGGCGGTGG + Intergenic
1203476174 Un_GL000220v1:150113-150135 GCGGCCCCCCTCCGCGGCGGTGG + Intergenic
1185457755 X:319232-319254 CCGAGCCTCGGCGGCGGCGGCGG + Intergenic
1187464456 X:19515173-19515195 CCCTCCACCCCCGGCGGCGGCGG + Exonic
1190108268 X:47574019-47574041 AGGTCCCCCTGCAGCGGCGGTGG + Exonic
1190285306 X:48957470-48957492 CCGCCGCGCCGCGGCGCCGGGGG + Exonic
1190286167 X:48962663-48962685 CCTTCCTCCCCTGGCGGCGGTGG - Exonic
1190542868 X:51496508-51496530 CTGTTCCCCGGCGGCGGCAGCGG - Exonic
1192393200 X:70752850-70752872 CCGTCCCCTGGCAGTGGCGGTGG + Intronic
1194127756 X:90040990-90041012 CCGCCCCCTGGCGGCTGCGGGGG + Intergenic
1194977597 X:100409725-100409747 TCCTCCCGCGGCGGCGGCGGCGG - Exonic
1194977598 X:100409728-100409750 GCTTCCTCCCGCGGCGGCGGCGG - Exonic
1198158510 X:133985352-133985374 GCGTCCGGCGGCGGCGGCGGGGG + Exonic
1198388142 X:136147721-136147743 CCAGCCCCGAGCGGCGGCGGCGG - Intronic
1198518542 X:137430452-137430474 GCGTCCTCCCGGGGCGGGGGAGG + Intergenic
1200155577 X:153972930-153972952 CCGCCCGGGCGCGGCGGCGGCGG + Intronic