ID: 1044719853

View in Genome Browser
Species Human (GRCh38)
Location 8:95134300-95134322
Sequence CGCCGCCGCCGCGGGGGGAC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 397
Summary {0: 1, 1: 0, 2: 11, 3: 43, 4: 342}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044719839_1044719853 9 Left 1044719839 8:95134268-95134290 CCGGGAGCGAGCCGCGCCCGCCC 0: 1
1: 0
2: 2
3: 36
4: 199
Right 1044719853 8:95134300-95134322 CGCCGCCGCCGCGGGGGGACGGG 0: 1
1: 0
2: 11
3: 43
4: 342
1044719838_1044719853 10 Left 1044719838 8:95134267-95134289 CCCGGGAGCGAGCCGCGCCCGCC 0: 1
1: 0
2: 2
3: 19
4: 204
Right 1044719853 8:95134300-95134322 CGCCGCCGCCGCGGGGGGACGGG 0: 1
1: 0
2: 11
3: 43
4: 342
1044719836_1044719853 17 Left 1044719836 8:95134260-95134282 CCGCCAGCCCGGGAGCGAGCCGC 0: 1
1: 0
2: 2
3: 15
4: 152
Right 1044719853 8:95134300-95134322 CGCCGCCGCCGCGGGGGGACGGG 0: 1
1: 0
2: 11
3: 43
4: 342
1044719835_1044719853 18 Left 1044719835 8:95134259-95134281 CCCGCCAGCCCGGGAGCGAGCCG 0: 1
1: 0
2: 0
3: 12
4: 190
Right 1044719853 8:95134300-95134322 CGCCGCCGCCGCGGGGGGACGGG 0: 1
1: 0
2: 11
3: 43
4: 342
1044719842_1044719853 -7 Left 1044719842 8:95134284-95134306 CCCGCCCGTAGGACGCCGCCGCC 0: 1
1: 0
2: 1
3: 12
4: 125
Right 1044719853 8:95134300-95134322 CGCCGCCGCCGCGGGGGGACGGG 0: 1
1: 0
2: 11
3: 43
4: 342
1044719833_1044719853 25 Left 1044719833 8:95134252-95134274 CCGCCGTCCCGCCAGCCCGGGAG 0: 1
1: 0
2: 1
3: 18
4: 271
Right 1044719853 8:95134300-95134322 CGCCGCCGCCGCGGGGGGACGGG 0: 1
1: 0
2: 11
3: 43
4: 342
1044719834_1044719853 22 Left 1044719834 8:95134255-95134277 CCGTCCCGCCAGCCCGGGAGCGA 0: 1
1: 0
2: 2
3: 6
4: 116
Right 1044719853 8:95134300-95134322 CGCCGCCGCCGCGGGGGGACGGG 0: 1
1: 0
2: 11
3: 43
4: 342
1044719843_1044719853 -8 Left 1044719843 8:95134285-95134307 CCGCCCGTAGGACGCCGCCGCCG 0: 1
1: 0
2: 0
3: 5
4: 102
Right 1044719853 8:95134300-95134322 CGCCGCCGCCGCGGGGGGACGGG 0: 1
1: 0
2: 11
3: 43
4: 342
1044719841_1044719853 -2 Left 1044719841 8:95134279-95134301 CCGCGCCCGCCCGTAGGACGCCG 0: 1
1: 0
2: 1
3: 2
4: 67
Right 1044719853 8:95134300-95134322 CGCCGCCGCCGCGGGGGGACGGG 0: 1
1: 0
2: 11
3: 43
4: 342
1044719830_1044719853 28 Left 1044719830 8:95134249-95134271 CCGCCGCCGTCCCGCCAGCCCGG 0: 1
1: 0
2: 6
3: 55
4: 459
Right 1044719853 8:95134300-95134322 CGCCGCCGCCGCGGGGGGACGGG 0: 1
1: 0
2: 11
3: 43
4: 342
1044719837_1044719853 14 Left 1044719837 8:95134263-95134285 CCAGCCCGGGAGCGAGCCGCGCC 0: 1
1: 0
2: 1
3: 15
4: 170
Right 1044719853 8:95134300-95134322 CGCCGCCGCCGCGGGGGGACGGG 0: 1
1: 0
2: 11
3: 43
4: 342

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044719853 Original CRISPR CGCCGCCGCCGCGGGGGGAC GGG Intronic
900180124 1:1307648-1307670 CGCGGCCGCCGGGGAGGGGCTGG - Intronic
900284072 1:1890950-1890972 AGCAGCCGCCGCGGCGGGACTGG - Exonic
901086112 1:6613457-6613479 CGGCTCGGCCGCGGGGGGAGGGG - Intronic
901797940 1:11691492-11691514 CGCCGCCGCCGCGAGGGCGCGGG - Exonic
902476835 1:16692890-16692912 CGCCGCCGTCTAGGGGCGACAGG + Intergenic
903555124 1:24187416-24187438 CAGCCCCGCCGCGGGGGGAGGGG + Intronic
904181401 1:28668997-28669019 CGCCGCCGCCGGGGAGCGAGCGG + Intronic
904245076 1:29181785-29181807 CGCCGCCGCCTAAGGGGGGCTGG - Exonic
904256905 1:29259992-29260014 CGCCCGCGCCGCGCGGGGCCTGG - Exonic
904642008 1:31938133-31938155 CGCCGCCGCCGGGCCGGGCCGGG - Exonic
904642013 1:31938139-31938161 CGCCGCCGCCGCCGCCGGGCCGG - Exonic
904822946 1:33256816-33256838 CGCCGCCGCCGCTCTGGGCCGGG - Intronic
905449432 1:38047069-38047091 CGCGGCCGCCACGTGGGGAGTGG + Intergenic
905569329 1:38991438-38991460 CGCCGCCGCTTCGGGGAGCCGGG - Exonic
906480955 1:46198478-46198500 CGCCGCTGCCGCGGGGTGAGAGG + Intronic
906637010 1:47416484-47416506 CGCCGCCGCCGCCCCGGGCCGGG - Exonic
907091408 1:51729483-51729505 CGCCGGCGCTGCTGGGGGAAAGG - Intronic
907178892 1:52553022-52553044 CGCTGCCGCCGCTGGAGGCCGGG + Intronic
907364169 1:53945976-53945998 CGAGGCCGCCGCGAGGGGGCGGG - Intergenic
908131839 1:61082370-61082392 CGCCGCCGCCGCGGGGGGGAGGG - Intronic
908401135 1:63774062-63774084 CGCCGCCGCCGAGGGAGCCCCGG + Exonic
908534637 1:65066703-65066725 CGCCGCCGCCGCGGGGACTCCGG + Intergenic
909352749 1:74673660-74673682 CGCCGCCGCCCCTGGGCGCCCGG + Exonic
910200145 1:84690553-84690575 CGGCGCCGGCGCGCGGGGGCGGG - Intronic
913205526 1:116534637-116534659 CAGCGCCGCCGCGGCGGGCCTGG - Intronic
913979475 1:143497119-143497141 AGCCGCGGCGGCGGGGGGGCGGG - Intergenic
914808376 1:151008407-151008429 CGCCTCCGCCGCTGGGGGCGGGG + Intronic
921909083 1:220528292-220528314 CGCCGCCGCCGCTGGGCCCCGGG + Intronic
922518199 1:226223741-226223763 CCCCGCCGGCGTGGGGGGCCCGG - Exonic
922917582 1:229271184-229271206 GGCCGCAGCCGCTGGGAGACCGG + Exonic
923684161 1:236142443-236142465 CGCCGCCCCCGCGCGCCGACCGG - Intergenic
924527139 1:244863275-244863297 CGGCGCCACCGCGGGCCGACCGG + Intronic
1063504013 10:6580170-6580192 CGCCGCCGCCGGGAGGGAGCGGG - Intronic
1064208966 10:13347770-13347792 CGCCGCCGCCGCGCGGGGCCGGG - Intronic
1066429273 10:35336660-35336682 CGCCGCAGCCGCCGGGGAAGCGG + Intronic
1070032610 10:72692187-72692209 CGCCGCCGCCCCGAGAGGAGAGG - Exonic
1070610050 10:77926734-77926756 GGCTGCCGCGGCGGCGGGACTGG + Intergenic
1072059740 10:91798476-91798498 CTCCGCCGCCGCGGGGCAGCCGG + Exonic
1073181776 10:101587923-101587945 CGCCGCAGCTGCGGGGAGATGGG + Exonic
1074169718 10:110919950-110919972 CGCCGCCGCCGCCGCAGGCCCGG - Intronic
1075031967 10:119029825-119029847 CGCGGCCGCGGCGGGGCGAGCGG - Exonic
1075040718 10:119104623-119104645 CGCCCCCGGCTCGGGGGAACCGG - Intronic
1075645370 10:124093010-124093032 CGCGGCCGGAGCGAGGGGACAGG - Intronic
1076358201 10:129867992-129868014 CGCGGCCACCGCGGGAGGAGAGG + Intronic
1076554205 10:131311513-131311535 CGCCGCCGCCGCCCTGGGTCTGG - Exonic
1079163258 11:18013235-18013257 CGCCGCCGGGGCGGGCTGACTGG - Intergenic
1079459758 11:20669465-20669487 CGCAGCCGCAGCGGGGGGCCGGG + Intergenic
1079689409 11:23403540-23403562 CGCCGCCGCCGCCGCGGGACGGG + Intergenic
1081699946 11:45146700-45146722 CGCCGCCGCCGCGCCGAGGCTGG + Intronic
1081832051 11:46121967-46121989 CGCCGCCGCCGCCGCTGCACTGG - Intergenic
1082792818 11:57359125-57359147 TGCCGCCCCCGCGGGAGGAATGG + Intronic
1082810610 11:57476955-57476977 AGCCGCAGCCCCGGGTGGACGGG - Exonic
1083595546 11:63916959-63916981 CGCCGCCGCCGCCGGTGCCCCGG - Intergenic
1083617966 11:64035779-64035801 CGCCGCCGCCGCGAGGGGAGAGG + Intronic
1084546846 11:69818946-69818968 AGCCGCCGCCGCCGCGGGGCGGG - Exonic
1085208099 11:74749162-74749184 CGCCGCCGACGCGGCGGGCCCGG + Exonic
1085561267 11:77474205-77474227 CGCCGCCGCCGCGCCGGGGAGGG - Intronic
1087076215 11:94129094-94129116 CGCCGCCGGCGGGGCGGGGCGGG - Exonic
1090784100 11:130033232-130033254 CGCCGGCGCAGCGAGGGGAGAGG - Intergenic
1090978391 11:131695037-131695059 CGCCGCCGCCGGGAGGGTGCAGG + Intronic
1091474048 12:753982-754004 CGCTGCCGCCCCTGGGGAACAGG + Exonic
1091823169 12:3491301-3491323 CGCCGCCGCCGCGGAGGCTTCGG + Exonic
1091823645 12:3493539-3493561 CCCCGCTGCCGCGCGGGGTCTGG + Intronic
1092727682 12:11500720-11500742 CGCCGCCACCGCCGGGGCCCAGG + Intronic
1096077641 12:48815143-48815165 CGCAGCCGCCGCCGGAGGATGGG + Intronic
1096191338 12:49622230-49622252 AGCCGCCGCCGCGGCAGGAGAGG - Intronic
1096241330 12:49961800-49961822 CGGGGCCGGCGCGGGGGGGCAGG - Intergenic
1096250067 12:50025299-50025321 CGTGGCCGCCGCGGGGGTCCGGG - Intronic
1096365485 12:51025886-51025908 CGTCGGCGCCGCAGGGGGCCGGG - Intronic
1096983734 12:55743390-55743412 CGCCGCCGCCGCGGGGCCCTCGG - Exonic
1097107671 12:56634956-56634978 CGCCGCCGCCGCCTGCGGCCCGG - Intronic
1097264414 12:57737508-57737530 CGCCGCCGCCGCCGGGGGAGGGG - Exonic
1098029049 12:66235412-66235434 GGCCGCCGCCGCGCGGCGAGAGG - Intronic
1098769722 12:74537990-74538012 CGACCCCGCCGCCGGAGGACTGG + Exonic
1100444820 12:94650585-94650607 CGCCGCCGCCGCCGCGGGGTGGG + Intergenic
1101965436 12:109279185-109279207 AGCCGCAGCCTCCGGGGGACAGG - Exonic
1103364012 12:120369332-120369354 CGCCGCCTCCGCGGGCGCCCGGG - Intergenic
1103433023 12:120904098-120904120 CGCCGCCGCCGCCGCGGGTGAGG - Exonic
1103510032 12:121467560-121467582 CGCGGCCGGAGCGCGGGGACTGG + Intronic
1103649638 12:122422634-122422656 CGCCGCCGCCGCCGCGGGGCCGG + Intergenic
1104865327 12:131950111-131950133 AGCCGCAGCCGCGGGCGTACAGG + Intronic
1106517011 13:30464932-30464954 CCCCACCGCGGCGGGGGGAGGGG - Intronic
1106539086 13:30674197-30674219 AGCGGCCGCCGCGGGGGGAGAGG + Intergenic
1107605108 13:42048854-42048876 CGCCGCTGCCTCGGCGGGGCCGG + Exonic
1107851386 13:44576466-44576488 CGCCGACGCGGCGGGAGGAGGGG - Exonic
1108292591 13:48976233-48976255 CGCCTCCTCCGGGGCGGGACGGG - Intronic
1108541498 13:51451736-51451758 CGCCGCCGCCGCTGCCGGGCCGG + Intronic
1110630187 13:77698180-77698202 CGCCGCGGCCTCAGGGGGCCTGG + Intronic
1112216315 13:97434311-97434333 CGCCGCCGCCGCCGGCGCCCAGG + Exonic
1112504543 13:99968335-99968357 CGCGGCCGCCGGGAGGGGGCAGG + Intronic
1114031530 14:18584240-18584262 CGCAGCCGCCAGGGAGGGACTGG - Intergenic
1114866202 14:26598007-26598029 CGCCGCCGCCGCTGCCGGAGCGG + Intergenic
1115320878 14:32077561-32077583 CGCGGCCGCCGAGGGGAGCCTGG + Intronic
1115474482 14:33800380-33800402 CGCCGCCGCCCTGCGGGGACGGG - Exonic
1115651160 14:35403976-35403998 CGCCGGGGCCGCGGGGGGAGGGG - Intronic
1116905087 14:50396634-50396656 CGCCGCCTCCGCGGGGAGCCGGG - Intronic
1118351007 14:64972378-64972400 CGCCGCCGCCCCGGAGAGAGGGG + Intronic
1118607678 14:67515346-67515368 CGCCGCGGCGGCGCGGGGTCCGG + Intronic
1119318430 14:73714433-73714455 CTCCGCCGCGGGGGCGGGACGGG - Intergenic
1120168030 14:81220940-81220962 CGCCGCCGCCGCCGAGAGACAGG + Intronic
1120881341 14:89417152-89417174 CGCCTCCGCCGCGGCGCGTCGGG + Intronic
1121703204 14:95971889-95971911 CGGGGCCCCCACGGGGGGACTGG + Intergenic
1122081816 14:99272054-99272076 CGCCGCGGGCCCGGGGGGAGCGG + Intergenic
1122231199 14:100306975-100306997 CACCGCCGCCGCGGGCGCGCAGG - Intergenic
1122544975 14:102517157-102517179 CGCCGAGGCCGCGGGGCGAGGGG - Intergenic
1122558137 14:102592451-102592473 CCCCGCCGCCCCGGACGGACGGG + Intergenic
1122601455 14:102923784-102923806 CGCCGCCGGCGCACGGGGTCCGG - Exonic
1122889068 14:104724297-104724319 CGCCGCCTGCGCCGGGGGGCCGG - Intronic
1123024875 14:105419857-105419879 CGCCGAGGCCGCGCAGGGACGGG - Exonic
1123396576 15:19943773-19943795 AGCCGCGGCCGCGGGGGGGTTGG - Intergenic
1125508785 15:40282025-40282047 CGCCGCCGCCGCTGCGGCCCGGG - Exonic
1127763628 15:62164588-62164610 CGCCGCCGCAGCTGTGGGCCCGG + Exonic
1128322029 15:66701161-66701183 CGCCGCGCCCGGGGGGGGAGGGG + Intergenic
1128322543 15:66703442-66703464 CGGGGCCGCCGCGGGGCTACCGG - Exonic
1129189250 15:73927799-73927821 CGCCCCCGCCGGGTGGGGAGCGG + Exonic
1129844990 15:78764081-78764103 CGCCGCAGCTGCGGGAGCACTGG + Exonic
1130224557 15:82046987-82047009 CGCCGCCACCGCGGGGACGCAGG + Intergenic
1130261140 15:82355274-82355296 TGCTGCCGCCGCCGGGGGAGAGG + Intergenic
1130280095 15:82513744-82513766 TGCTGCCGCCGCCGGGGGAGAGG - Intergenic
1130471470 15:84229930-84229952 TGCTGCCGCCGCCGGGGGAGAGG - Intergenic
1130478964 15:84344501-84344523 TGCTGCCGCCGCCGGGGGAGAGG - Intergenic
1130492806 15:84443630-84443652 TGCTGCCGCCGCCGGGGGAGAGG + Intergenic
1130593764 15:85234557-85234579 TGCTGCCGCCGCCGGGGGAGAGG - Intergenic
1130979447 15:88803023-88803045 TGAGGCCGCCGCGGCGGGACAGG - Intergenic
1131827006 15:96330389-96330411 CGCCGCCGCCGAGAGGGGGATGG - Intronic
1132255571 15:100373478-100373500 CGCCGCCGCCGCGCCTGGCCGGG - Intergenic
1132398237 15:101489580-101489602 CGCCGCGGGCGCGGGGGGCGCGG - Exonic
1132629396 16:909715-909737 CGCAGCTGCCCCGGGGGGACAGG + Intronic
1132641872 16:981774-981796 CGCCGCCGCCGCCGAGGCTCGGG - Intergenic
1132757522 16:1493338-1493360 CGCCTGCGCTGCGCGGGGACGGG - Intronic
1132877964 16:2148670-2148692 CGCCGCCGCCGCCAGGGGAAGGG + Exonic
1132889534 16:2196885-2196907 CGCGGCCGCCGGGGGTGCACTGG + Intergenic
1133156586 16:3880509-3880531 CGCCGCCGCCGCCGGGCTCCGGG + Exonic
1133311307 16:4848133-4848155 CTGCGCCGCCGCCCGGGGACCGG + Intronic
1135821887 16:25692388-25692410 CGCCGCCGCCGCCGCGAGCCGGG + Exonic
1136414744 16:30096229-30096251 TGCCGCCGCTGCGGCGGGAGGGG + Intronic
1136453954 16:30370097-30370119 CGCCGCCGCCCCGGGGTTCCCGG - Exonic
1136546534 16:30958019-30958041 CGCCGCCACCGCTGCGGGGCCGG + Intronic
1138327881 16:56191091-56191113 CGCCGCCGGCGCGTGGGGCGGGG + Intergenic
1138360751 16:56425442-56425464 CGCCGCCGCCGCGCCGGGCCGGG + Exonic
1138651471 16:58463726-58463748 CGCCGCCGACGCGCGGGTGCAGG - Intronic
1139364833 16:66427048-66427070 CGCCGCCGCCGAGGGGGGCCGGG + Intergenic
1139637119 16:68264515-68264537 CGCCGCCGCCGCGGCAGCTCAGG - Intronic
1140427772 16:74875197-74875219 CTCCACCGCCGGGCGGGGACTGG + Intronic
1141054616 16:80804017-80804039 CGCCGCCGCCGCCGCGGGCTCGG + Intronic
1141582724 16:85011324-85011346 CGCCGCCGCCGCCGCAGGCCGGG - Exonic
1141608608 16:85169325-85169347 CGCCGCCGCCGGGGGGTGCTCGG + Intergenic
1141683377 16:85556637-85556659 CTCCGCCGCCGCGGCGGAGCCGG - Intergenic
1141958828 16:87391614-87391636 AGGCGCCGCGGCAGGGGGACTGG + Intronic
1142179780 16:88662792-88662814 GGCAGCCGTCGCGGGGGAACGGG + Intronic
1142627859 17:1203617-1203639 CGCCGCCGCTGCGAGGAGCCCGG + Intronic
1142811796 17:2399017-2399039 TGCCGCCGCCGCGGCGGGCGGGG - Intronic
1142860126 17:2756030-2756052 CGCCCCCGCGGGAGGGGGACGGG - Intergenic
1143483401 17:7239470-7239492 GGCCGGCGGCGCGGGGGGAGGGG - Exonic
1143527265 17:7479699-7479721 CGCCGCCGCCGAGAGGAGGCCGG + Intronic
1143742582 17:8965417-8965439 CGCTGCCCCCGCGGTGGGCCAGG + Intronic
1143783249 17:9240282-9240304 CGCGGCCGCCGTGGAGGGGCTGG + Exonic
1145765517 17:27456269-27456291 CGCGGCCGCCGGGAGGGGAGGGG + Intergenic
1146034059 17:29390718-29390740 CGTCGCCGCCTCGGGGGAACCGG - Exonic
1147620774 17:41865262-41865284 CGCCGCCGGCTCGGCAGGACTGG - Exonic
1148262241 17:46193556-46193578 CGCCGCCCCCGCGGGCCGCCAGG + Intronic
1148440416 17:47709022-47709044 CGCCGCCCCCGCCGGGCGAGAGG + Exonic
1148556595 17:48582224-48582246 CGCCGCCGCCGCCGGTGCGCAGG - Intronic
1148698631 17:49575659-49575681 CGCCGCCGCCGCCGGTGGGAGGG + Intergenic
1148755767 17:49972239-49972261 CGGTGCCGCCGCGGGGGATCTGG - Intronic
1148787200 17:50151115-50151137 CGCAGCCGCCGCTGGGGGACTGG + Intergenic
1150003657 17:61456655-61456677 CGCCGCCGCCGCCGCGGAGCAGG + Exonic
1150643592 17:66965067-66965089 CGCCGCGGGCGCGGCGGGGCGGG - Exonic
1150840384 17:68601018-68601040 GGCTGCCACCGCGGGCGGACGGG + Exonic
1152222148 17:79074841-79074863 CGCTGACGCCGCGCTGGGACGGG - Intergenic
1152468554 17:80478360-80478382 CGCAGACCCCGCGTGGGGACCGG - Intergenic
1152646012 17:81468900-81468922 CTCAGCCGCCGCGGGGTCACCGG + Intergenic
1155053819 18:22169038-22169060 CGCCGCCGCCGCGGCGGGAGGGG - Intergenic
1155257880 18:24014517-24014539 GGCGGCCGCCGCTCGGGGACCGG + Intronic
1155928810 18:31685100-31685122 CGCGGCGGCCGCGGGGCGCCGGG - Intronic
1157753010 18:50194977-50194999 CGCCGCCGCGGCGGGAGTAAAGG - Exonic
1158954165 18:62523606-62523628 CGCCGCCGCCCCGGGGACTCGGG + Exonic
1160873063 19:1285798-1285820 TGCCCCGGCCGCGCGGGGACTGG - Intergenic
1160960605 19:1719048-1719070 TGCCGCCGCCGCAGCGGGGCTGG + Intergenic
1161513201 19:4683061-4683083 CCCCGCCGCCGCAGAGGGCCGGG + Intronic
1161703248 19:5805944-5805966 CGCCGCCGCCGCCGGGGACACGG + Intergenic
1161741042 19:6021456-6021478 GGTCGCCGCCACGGAGGGACTGG + Intronic
1161852743 19:6746091-6746113 CACGGCCGGAGCGGGGGGACGGG - Intronic
1162033250 19:7926178-7926200 CGGGGCCGCCGCGGGGGGCGGGG + Intergenic
1162597447 19:11640094-11640116 CGCAGTTGCCGCGCGGGGACCGG - Intergenic
1162604213 19:11694586-11694608 CGCAGTCGCCGCGAAGGGACGGG + Intergenic
1162615748 19:11798928-11798950 CGCAGTCGCCGCGTAGGGACGGG - Intronic
1162630806 19:11925470-11925492 CGCAGTCGCCGCGCAGGGACGGG - Intronic
1162646258 19:12052579-12052601 CGCAGTCGCCGCGCAGGGACCGG + Intronic
1162705330 19:12551112-12551134 CGCAGTCGCCGCGCAGGGACGGG + Intronic
1162713180 19:12611203-12611225 CGCAGTCGCCGCGCAGGGACGGG - Intronic
1163138648 19:15331963-15331985 CGCGGGCGCCGCGGCGGGGCCGG - Intronic
1163154469 19:15432486-15432508 CGCCACCGCCGCCGCGGGACGGG - Intronic
1163365915 19:16876141-16876163 CGCGGACGCAGCGGGAGGACAGG - Exonic
1163513082 19:17747720-17747742 CGCCGCAGCCGCGGAGGGAGGGG + Exonic
1163743896 19:19033493-19033515 CGCCGCCGCCGCGCGAGGCGGGG + Intronic
1165349792 19:35269313-35269335 CGCCGCCGAGGCCGGGGGCCGGG - Intronic
1165657718 19:37548901-37548923 CGCCACCGTTGCCGGGGGACTGG + Intergenic
1165871479 19:38975991-38976013 AGACGCCCCCGCGGGGGGACTGG + Intergenic
1166100359 19:40567979-40568001 CTCCGCCGCCGCGGGGGTCGCGG - Exonic
1166106692 19:40601246-40601268 CGCGGCCGCCGGGGAGGGAGTGG + Intronic
1166894666 19:46016077-46016099 CGCCCCCGACGCGGGAGGACCGG + Exonic
1166984142 19:46649575-46649597 AGGCGCCGCCGCCGGGGGGCGGG - Exonic
1167074990 19:47243228-47243250 CGCCGCAGCCGCGGGGCTCCGGG + Intergenic
1167557120 19:50203532-50203554 CGGCCCCGCCCCTGGGGGACGGG - Intronic
1168064012 19:53909331-53909353 GGCCGCGGCCGCGGGGGGTGGGG + Exonic
1202710850 1_KI270714v1_random:18714-18736 CGCCGCCGTCTAGGGGCGACAGG + Intergenic
926217096 2:10912351-10912373 CGCCGCTGCCGCTGGGGGTCCGG - Exonic
927652293 2:24920042-24920064 CGCCGCCGCCGCGGGTGCAGGGG - Intergenic
927714046 2:25341433-25341455 CGCCGCTGCCGCAGGGGCCCCGG - Intronic
927938127 2:27086679-27086701 CGCCTCCGCCGCGGAGGAGCAGG - Intergenic
931253503 2:60552413-60552435 CGCCGCCGCCGCCGAAGGGCAGG - Intronic
932345883 2:70994884-70994906 CGCCGCCGCCGAGAGGAGCCCGG + Exonic
934933213 2:98445115-98445137 CGCGGCCGCCGCGGGGGCCGGGG + Intronic
935592778 2:104856383-104856405 CGCCGCCGCCGCCGTGGTGCGGG - Exonic
935746510 2:106194084-106194106 CCCCGGCGCCGCGGTGGGCCGGG - Intronic
937283397 2:120735735-120735757 CGCCGCCGGGGCGGGGGGAGGGG - Intronic
938414496 2:131093206-131093228 CGCCGCCGCGGCGCGGTGAGTGG - Intronic
938496666 2:131801553-131801575 CGCAGCCGCCAGGGAGGGACTGG + Exonic
938496794 2:131801987-131802009 CGCTGCCGCCGGCTGGGGACTGG - Intergenic
940640760 2:156342379-156342401 TGCCGCAGCCGCCGGGGGCCGGG - Intergenic
941020965 2:160407653-160407675 GGCCGCCGCCGCGCGGCGAGAGG - Intronic
942151064 2:173076156-173076178 CGCCGCCGCCGGGCGGGCCCTGG - Intronic
942241107 2:173964673-173964695 CGCCGCCGCCGGGGGGCGGGTGG - Intronic
942241109 2:173964676-173964698 CGCCGCCGCCGCCGGGGGGCGGG - Intronic
942453544 2:176123019-176123041 CGCCGCCGCTGCCGGGGGCTGGG - Exonic
943185162 2:184598306-184598328 CGCCGCTGCCGCAGAGGGCCGGG - Intergenic
943571511 2:189580777-189580799 CGCCGCCGCCGCCGTGGGCCGGG + Exonic
943669792 2:190648857-190648879 GGCCGCCGCCGGGCGGGGGCGGG - Intronic
946921424 2:224585152-224585174 CGCCGCCGCCGCGGCTGCCCAGG - Exonic
948467434 2:238159067-238159089 GGCCGCCGCCGCCGCGGGCCTGG + Exonic
1169065557 20:2692791-2692813 CGCCGCCGCTCCCGGGGGAGCGG - Intergenic
1169065684 20:2693164-2693186 CGCTGGCGCCGCGGGCGGGCGGG + Intronic
1169214732 20:3786516-3786538 CGCCGCCGCCGCCCCGGGGCGGG + Exonic
1169214736 20:3786519-3786541 CGCCGCCGCCCCGGGGCGGGGGG + Exonic
1170596098 20:17806950-17806972 CCCAGCCGCCCCGGGGGGGCAGG + Intergenic
1171034717 20:21705889-21705911 CGCCGCCGCCGCCGCGTGAGAGG - Exonic
1171499834 20:25585180-25585202 CGCCGCCGCCGTCGGGAAACCGG + Intronic
1172587269 20:36093477-36093499 CGCCGCCGCCGCTGGGAGCTGGG + Intronic
1172640189 20:36436105-36436127 CGCCGCCGCCGCCGGGCACCTGG - Exonic
1173813735 20:45971847-45971869 AGCCGCCTCCGCAGGGGAACCGG - Intronic
1175847007 20:62064803-62064825 CGCAGCCGCCGCGCCGGGCCCGG + Exonic
1175962097 20:62642436-62642458 CGCCCCCGCCGCAGAGGGAGGGG - Exonic
1176856987 21:13981374-13981396 CGGCGCCGGGGTGGGGGGACTGG - Intergenic
1176867610 21:14062849-14062871 CGGCGCCGGGGTGGGGGGACTGG + Intergenic
1178513828 21:33229896-33229918 CGCCGCCGGCGCGGGGGCGGGGG - Intronic
1178922591 21:36748123-36748145 CGCCGCAGCCCCGGGAGGCCGGG - Exonic
1178992482 21:37367203-37367225 CGCCGCCGCCGCCCGGGCCCCGG + Intronic
1180037800 21:45258719-45258741 CTGGGCGGCCGCGGGGGGACTGG + Intergenic
1180064337 21:45405132-45405154 AGCCGCCGCCGCTGGGAGGCCGG - Intronic
1180455642 22:15511297-15511319 CGCAGCCGCCAGGGAGGGACTGG - Intergenic
1180649960 22:17369511-17369533 CGCCGCCGCAGCCGCGGGATGGG + Exonic
1181162046 22:20965147-20965169 GGCCGCGGGCGCGGGGGGGCGGG - Exonic
1181270823 22:21657628-21657650 CGCCGCGGCCGTGGGGAGAGAGG + Intronic
1181478095 22:23180839-23180861 CGCCGCCGCCGCGCGGGCCATGG + Exonic
1181510856 22:23388215-23388237 CGCGGCTGCGGCGGGGGCACTGG - Intergenic
1183702166 22:39457106-39457128 CTCCGCCGCCGCGCCGGGCCGGG - Intergenic
1184095522 22:42314330-42314352 AGCTGCCGCTGCCGGGGGACAGG + Intronic
1185055261 22:48575859-48575881 CACCGCCGCCGCGGCGGGCCAGG - Intronic
1185278624 22:49960659-49960681 CGCCGCCGCCTCGCGGGCCCCGG + Exonic
1185316172 22:50180138-50180160 CTCAGCCGCGGCGGGGGGCCCGG - Exonic
1185333524 22:50261815-50261837 GGCCGCCGCCGGGGGAGGGCCGG + Exonic
1185336180 22:50271785-50271807 GGCCGCGGCCGCCGGGGGAGGGG + Intergenic
949970248 3:9397678-9397700 CGCCGCCGCTGCCGGGGGAGGGG + Intronic
950168026 3:10816206-10816228 CGCCGCCGCCCCGGGCGAGCTGG - Exonic
950316395 3:12004941-12004963 CGCCGCCGCCCTCGGGGGTCGGG + Intronic
951217767 3:20040603-20040625 CGCCGCTGCCGCCGGGGGCTCGG + Exonic
952241158 3:31532712-31532734 CGCCGCCGCCGCAGCTGCACTGG + Intronic
953947578 3:47163360-47163382 CGCCGCCGTCGCGGGGAGGTCGG + Intronic
955387636 3:58492155-58492177 CGCCGCCGCCGCGCAGTGAGTGG + Intronic
957405140 3:79766568-79766590 CGCCGCTGCCCCGGGTGGAGCGG + Intronic
959530734 3:107431541-107431563 CGCCGCCGCCGCCGGGGCTCGGG + Intergenic
961827257 3:129605652-129605674 CGCCGCCGGCGCCGTGGGGCAGG + Exonic
965648332 3:170908304-170908326 CGTCGCCGCCGCGGCCGCACAGG + Intronic
966182144 3:177197343-177197365 TGCTCCCGCCGCGGGGGGAGGGG + Intronic
966595871 3:181724379-181724401 CGCTGCCGGCGCGGGTGTACTGG + Intergenic
967493775 3:190120985-190121007 CGCCGCTGCAGCGGGGAGCCTGG - Intronic
967904101 3:194486792-194486814 CGCCGCCGCCGCGGGCGCGGAGG - Intronic
968965277 4:3766333-3766355 CGACGCGGCTGCGGGGGGAGGGG - Intronic
969360232 4:6658688-6658710 CGCCGCCCACGCGGGGCGCCGGG - Intergenic
970202880 4:13627489-13627511 CGCCGCCGCCGCCGGGCCCCGGG - Exonic
970333284 4:15004656-15004678 CGCCGGGGCCGCGGGCGGCCGGG + Intronic
972162582 4:36244511-36244533 CCCCGCCCCCGCGGGCGGAGAGG - Intergenic
975166712 4:71186583-71186605 CGCCGCCTCCGCCGGGGGCTTGG - Intergenic
979231503 4:118352908-118352930 CGCGGCCGCCGCCAGGGGACAGG - Exonic
979547163 4:121951556-121951578 CGCCGCCGCCGGGGCTGGAGGGG - Exonic
980130062 4:128809965-128809987 CGCCGTCGCCGCCGCGGGACCGG - Intronic
980930253 4:139177353-139177375 CCCCCCCGCCGCGTGGGGAGGGG - Intergenic
981270744 4:142845723-142845745 CGCCGCCGCCGCCGCCGGCCTGG - Intronic
981782628 4:148444765-148444787 CGCCGCCGCTGGGGGCGGGCGGG - Intergenic
982712211 4:158768951-158768973 CGCCGCCGCCGTGGGGCTGCGGG + Intergenic
983904362 4:173168974-173168996 CGCTGCCGCCGGAGGGGGCCGGG - Intronic
985895500 5:2748357-2748379 CGTAGCCGCCGCCCGGGGACCGG + Exonic
987050760 5:14144767-14144789 AGGCGCCGCCGCTGGGGTACCGG - Intronic
988578027 5:32444912-32444934 CCGCGCGGCCGCGGGGCGACGGG + Intergenic
989584785 5:43066376-43066398 CAGCGGCGCCGCCGGGGGACTGG + Intronic
990347446 5:54884123-54884145 CGGGGCCGCCGCGGCGGGATGGG - Intergenic
990955153 5:61332812-61332834 CGCCGCCGCCGCGGGGGCCGGGG + Exonic
992939919 5:81751435-81751457 CGCGGGCGGCGCGGGGGGAGGGG - Intronic
995052738 5:107724771-107724793 GGCCGCCGCCGCCGGGGGCCGGG - Intergenic
995342260 5:111073039-111073061 GGACGCCGCCGCCGGGGGAAAGG + Intronic
995650411 5:114362363-114362385 CGCCCCCGCCGCCGGGGCACCGG - Exonic
996862877 5:128084506-128084528 CGCCGCCGCCGCCGGAGTGCAGG - Exonic
997319157 5:132963577-132963599 CGTCGCCGCCGCCAGCGGACGGG - Exonic
997703983 5:135930172-135930194 CGCCGCCCCTGCGGGAGGAGCGG + Intronic
997975411 5:138439070-138439092 AGCAGCCGCCGCGGGGGCAGCGG - Exonic
1000305059 5:159987274-159987296 CGCCCCCGCCGCAGGAGGATCGG - Intergenic
1002524364 5:179807031-179807053 CGCCGGCGCCGCGAGGGGGTGGG + Intronic
1004607253 6:17206381-17206403 CGCCTGGGCCGCGGGGGGAGGGG + Intergenic
1004924532 6:20403859-20403881 CGCCGACGCCGCGGGGGCACCGG + Intronic
1007689213 6:43687834-43687856 CGCCGCCGCAGTGGTGGGGCAGG + Intergenic
1008932469 6:56954936-56954958 CGCCGCCGCCGCGGCCGCCCGGG + Intergenic
1011128741 6:84033713-84033735 CGCCGCCTCCGCTGCGGGTCGGG + Intergenic
1016330065 6:142945844-142945866 CCCGGCCGCCGCCGGGTGACAGG + Intergenic
1017146772 6:151241252-151241274 GGCCGCTGCCGCAGGAGGACTGG - Intronic
1017672491 6:156779559-156779581 CGCCGCCCCCGCGGGAAGACGGG - Intronic
1018400491 6:163415138-163415160 CGCCGCCGCCGCCGCCGGAGAGG - Exonic
1018686281 6:166307296-166307318 CGCGGCTGCCGCGCGGGGCCGGG - Exonic
1019474251 7:1236437-1236459 CGCCGCCGCCGCCGCGGGGCTGG + Exonic
1021668616 7:23013493-23013515 CGCCGCGGCAGGGAGGGGACGGG + Intronic
1022101665 7:27172995-27173017 CGCGGCCCACGCGGGGGGAGGGG - Intronic
1024579946 7:50793331-50793353 CGCCGGCGGCGCGGGGCGCCCGG - Intronic
1024963802 7:55004602-55004624 CGCCGCGGCCGCGGGGAGCAGGG + Intergenic
1025069676 7:55887590-55887612 CGCCGCCGCCGCGGTGGACCCGG - Intronic
1026732753 7:72925568-72925590 CGCCGCCGCTCCGGAGGGCCAGG + Intronic
1026909470 7:74083900-74083922 CGCCGCCGGCCCGGGGAGGCGGG - Intronic
1029109562 7:98205717-98205739 GGCCGCGGCCGCGGGTGCACGGG - Exonic
1029535277 7:101154337-101154359 CGCCGACGCCGCGGGGAGCGCGG - Intergenic
1029640416 7:101816433-101816455 CGCCGTTGCCGCCGCGGGACCGG + Intronic
1031051882 7:116953440-116953462 CGCCGCCGCCGCCGCGGCCCGGG - Exonic
1031604224 7:123749025-123749047 CGCCGCCGCTGCGGGAGGGTTGG - Exonic
1032074513 7:128830216-128830238 CGCCGCCCGGGCGGCGGGACGGG - Intergenic
1032174351 7:129611689-129611711 CGCCGCCGCCGAGGAGGGGGAGG - Intergenic
1034262304 7:149764732-149764754 CGGCGCCACCTCGGGGGGAGCGG + Exonic
1034342770 7:150368842-150368864 CGCTGTCGCCGCGGCGGGGCGGG + Exonic
1034434760 7:151058146-151058168 CGGCGCCGCGGCGGGGCGCCCGG - Exonic
1034522628 7:151632327-151632349 CGCCGCCGCCGCAGGTGGCGCGG + Intronic
1035169534 7:157009939-157009961 CGCCGCCGCCGCTGGGGGCCTGG - Exonic
1036432327 8:8702376-8702398 CGCCGTCGGCGCGGCGGGCCGGG + Exonic
1036723693 8:11200968-11200990 CGCCGCCGCCGCAGGTGGAGCGG - Exonic
1038429857 8:27491324-27491346 CGCCGCCGCCGCAGTGGGTCGGG + Intronic
1038632924 8:29262895-29262917 CTCGGCCGCCGTGGGGGGTCCGG - Intronic
1039921458 8:41896779-41896801 CGCCGCCGCCGCCGCAGGAGAGG - Intergenic
1039949015 8:42153271-42153293 CGCCGCGGCTGCGGGCGGAGGGG + Intronic
1040065599 8:43141303-43141325 CGCCGCCGCCTGGGAGGGGCCGG + Intronic
1041673632 8:60516908-60516930 CGCCGGCGCCGCCGGAGGAAAGG - Exonic
1043053357 8:75407973-75407995 CTCCGCCGCCGCCCGGGGCCCGG + Intronic
1043502807 8:80873844-80873866 CGCCGCCGCCGCGCAGCGCCGGG - Intronic
1044599707 8:93991551-93991573 TGCCCCCGCCGCGGGGAGCCGGG - Intergenic
1044719853 8:95134300-95134322 CGCCGCCGCCGCGGGGGGACGGG + Intronic
1044832306 8:96262008-96262030 CGCCGCCACCGCGGCAGGACGGG + Exonic
1045305180 8:100951815-100951837 CGCCGCCACCGCGGGGCGAGTGG + Intronic
1045564365 8:103298796-103298818 CGCCGCCGCCGCCGCGAGCCCGG + Intronic
1045674067 8:104588986-104589008 CGCCGCCGCCGCCGAGCCACCGG + Exonic
1045738011 8:105318838-105318860 CGCCGCCGCCGCCGCTGGCCAGG - Exonic
1049585306 8:143430169-143430191 CGCCGCCGCCGCCGGTGCCCGGG + Exonic
1049762195 8:144336647-144336669 CGCCGCCGCCCCCGGGGGCATGG - Intergenic
1049784651 8:144444568-144444590 CGCCGCCGCCGTCGAGGGGCGGG - Intergenic
1049788577 8:144462775-144462797 CGCCGCCGCCTCAGTGGGCCCGG + Intronic
1049845500 8:144798948-144798970 CGCGGCCGCGGGGCGGGGACTGG + Intronic
1052991792 9:34522944-34522966 CGCTCCCGCCGCGGCGCGACCGG + Exonic
1054541683 9:66270027-66270049 CGCCACCGTCGCCGGGGGATGGG + Intergenic
1054798636 9:69325418-69325440 CGCGGCCGCAGCGGGGGCAGCGG - Intronic
1054835650 9:69672545-69672567 CGCCGCCGCCGCGGGCTCGCGGG - Intergenic
1055514231 9:77020415-77020437 CGCCGCGGCCGCGGCGGCAGCGG - Exonic
1056676891 9:88683464-88683486 CCCCGGCGCCGCGGGAGGAGAGG - Intergenic
1057259655 9:93576640-93576662 CGCCGCGGCCGGGAGGGGACGGG - Exonic
1057489149 9:95508373-95508395 CGCCGCCGCCGCCGCGGGGACGG + Exonic
1057489151 9:95508376-95508398 CGCCGCCGCCGCGGGGACGGAGG + Exonic
1057489274 9:95508880-95508902 CGCCGCCGCCGCGGGGTCCGAGG + Intronic
1057533484 9:95875728-95875750 CGCCGCCGCCGGAGGAGGACAGG - Exonic
1057596119 9:96417654-96417676 CGCCGCCGCCTCGGGAGGTGAGG - Exonic
1057997148 9:99828723-99828745 CGCAGCCGCCGCGGGCAGCCAGG + Exonic
1058851214 9:109013502-109013524 CGCCGCCGCCTCGGGCGGGTGGG - Exonic
1059633944 9:116154357-116154379 CGCCGCCGCCGGGCGGTGCCTGG + Exonic
1060514604 9:124258048-124258070 CTCGGCTGCCGCTGGGGGACCGG - Exonic
1061261398 9:129482708-129482730 CGCCGCCGCGGCGTGGGGGCGGG + Intergenic
1061559676 9:131394349-131394371 CGCGGCCGCCGCCGGGGGCCCGG + Intronic
1061609987 9:131739841-131739863 CCGGGCCGCCGCGGGGCGACAGG + Intronic
1061721958 9:132557354-132557376 AGCCACCGCCGTGGGGGCACGGG + Intronic
1061863356 9:133478979-133479001 CGCCCCCGTCGCCAGGGGACAGG - Exonic
1062346722 9:136118485-136118507 CGCCGCCGCGGAGAGGGCACCGG - Exonic
1185457753 X:319231-319253 CGCCGCCGCCGCCGAGGCTCGGG - Intergenic
1185506783 X:637610-637632 CTCCATCGCCGCGGGGGGAAAGG + Intronic
1185874484 X:3691417-3691439 CTCCCCCGGGGCGGGGGGACTGG - Intronic
1186669939 X:11758157-11758179 CGCCGTGGCCGGGGGGGGCCGGG - Exonic
1186669996 X:11758364-11758386 AGGTGCCGCCGCGGAGGGACAGG + Exonic
1187507267 X:19887755-19887777 CGCGGCCGCCGGGCGGGGGCGGG + Intergenic
1187826286 X:23335261-23335283 CGCCGCGGCCGCGGTCGGGCTGG + Intronic
1189324042 X:40102456-40102478 CGACGCCGCCGCGCTGGGCCGGG + Intronic
1190789167 X:53683545-53683567 CGCCGCCGCAGTGGGCGGATTGG - Intronic
1196214627 X:113035936-113035958 TGCCGCCACTGCTGGGGGACTGG + Intergenic
1196684026 X:118495708-118495730 CGCCGCCGACGCCGTGGGGCAGG + Intergenic
1197754026 X:129982732-129982754 CGCCGCCGCCGCCGAGAGAGAGG + Intronic
1200292483 X:154886325-154886347 CGCCGCCGCAGCTGGCGGGCGGG - Intronic
1200339327 X:155382065-155382087 CGCCGCCGCAGCTGGCGGGCGGG - Intergenic
1200347143 X:155458628-155458650 CGCCGCCGCAGCTGGCGGGCGGG + Exonic