ID: 1044720049

View in Genome Browser
Species Human (GRCh38)
Location 8:95136131-95136153
Sequence CTGCTATGTTCTTGGCATGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 343
Summary {0: 1, 1: 0, 2: 1, 3: 47, 4: 294}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044720049_1044720052 -9 Left 1044720049 8:95136131-95136153 CCTGCATGCCAAGAACATAGCAG 0: 1
1: 0
2: 1
3: 47
4: 294
Right 1044720052 8:95136145-95136167 ACATAGCAGATGCTCAGGAAAGG No data
1044720049_1044720053 0 Left 1044720049 8:95136131-95136153 CCTGCATGCCAAGAACATAGCAG 0: 1
1: 0
2: 1
3: 47
4: 294
Right 1044720053 8:95136154-95136176 ATGCTCAGGAAAGGTTTGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044720049 Original CRISPR CTGCTATGTTCTTGGCATGC AGG (reversed) Intronic
900853205 1:5159977-5159999 CTGCTTTATTCTAGCCATGCTGG + Intergenic
901138250 1:7011514-7011536 CCGCCATGTTCATGGCATGGGGG - Intronic
901230214 1:7637538-7637560 CTGCTATGCCCTTTGCATGGAGG - Intronic
901952270 1:12758552-12758574 CTGCTATGGTCTGGAAATGCCGG - Intronic
902149506 1:14431613-14431635 CTGCTTTGTTCTAGCAATGCTGG - Intergenic
902977173 1:20097407-20097429 CTGCTATGGTCCAAGCATGCTGG - Intergenic
903836016 1:26203725-26203747 CAGCTATGTCCCTGGGATGCAGG + Intergenic
904954964 1:34275453-34275475 CTACTGTGTGCTGGGCATGCTGG - Intergenic
907285967 1:53379877-53379899 CTGCCATGGTCTTGAGATGCAGG + Intergenic
908338668 1:63153914-63153936 CTTATATGTTCTTGGGATGGGGG - Intergenic
910092302 1:83479631-83479653 CTGGCATGTTCTTGACATTCAGG + Intergenic
910471485 1:87557953-87557975 CTACTATGTGCTGGGCATGATGG + Intergenic
911403675 1:97408765-97408787 CTGCTTTATTCTAGTCATGCTGG - Intronic
912865687 1:113254278-113254300 CTGCTATGTTCTTTGTTTCCAGG + Intergenic
914705184 1:150164281-150164303 GTCCTATGTCCTTGGCATGCAGG + Intronic
914941730 1:152029084-152029106 CTGCTTTGTTCTAGCCACGCTGG - Intergenic
917439343 1:175053251-175053273 TTGCTATGTTCTAAGCATGGAGG - Intergenic
917494012 1:175523894-175523916 CTGCTATGTACATGGCAGGGAGG - Intronic
917495771 1:175538798-175538820 CAGCTACTTTCTTGGCATACAGG + Intronic
917531650 1:175841438-175841460 GTGCTAGGTTCTGAGCATGCTGG - Intergenic
917942207 1:179933568-179933590 CTGCTTTGTTCTAGCCATGCTGG + Intergenic
918887232 1:190210852-190210874 CTGCTTTATTCTAGCCATGCAGG - Intronic
920595445 1:207264712-207264734 CTGCTGTGTTCTAGCCATTCTGG - Intergenic
920957902 1:210636078-210636100 CTGCTGTGTTCTTGTACTGCTGG + Intronic
922494584 1:226046655-226046677 CTGCTTTGTTCCAGCCATGCTGG + Intergenic
923031617 1:230253369-230253391 CTGCCATGTGCCTGGCATTCTGG + Intronic
923832678 1:237575294-237575316 CTCCTAGGTTCTTGGTATGGAGG - Intronic
1062993008 10:1837416-1837438 CTGCTTTATTCTAGCCATGCTGG - Intergenic
1065240903 10:23703129-23703151 CTGCTATAGTCCTGGCATGTGGG + Intronic
1065377968 10:25061880-25061902 CTGCTATGTTCTTTATATGTAGG + Intronic
1065681708 10:28241718-28241740 CTGTTATGTTCCTGGCTTTCGGG - Intronic
1065835634 10:29655476-29655498 CTGCTTCGCTCTTGCCATGCTGG + Intronic
1066752126 10:38668753-38668775 CTGCTTTATTCTAGCCATGCTGG + Intergenic
1066964906 10:42254300-42254322 CTGCTTTATTCTAGCCATGCTGG - Intergenic
1068937441 10:62649812-62649834 CTGCTTTGTTCTAGCCACGCTGG - Intronic
1069146060 10:64892830-64892852 CTGCTTTGTTCTAGCCATGCTGG - Intergenic
1071437152 10:85657925-85657947 TAGCCATGTTCTTGGCATGCAGG - Intronic
1071652146 10:87401779-87401801 CTGCTTTGTCCTAGCCATGCTGG - Intergenic
1071674387 10:87641039-87641061 CTGCTTTGTTCTAGCCATGCTGG + Intergenic
1072590052 10:96820757-96820779 CTGCTTTGTTTTTGCCACGCTGG - Intergenic
1073752995 10:106550851-106550873 CTGCTTTATTCTAGCCATGCTGG + Intergenic
1073854324 10:107657220-107657242 CTGGTCTGTTCTTGGCACCCAGG + Intergenic
1074464407 10:113668697-113668719 CTGCTTTGTTCTAGCCAAGCTGG + Intergenic
1074531151 10:114299761-114299783 CTGCTTTATTCTAGCCATGCTGG - Intronic
1075165739 10:120066783-120066805 CTGCTTTGTTCTAGCCATGCTGG + Intergenic
1075312089 10:121422880-121422902 CTGCTGAGTACTTGGCATGGTGG - Intergenic
1075986983 10:126796786-126796808 CTGAGATGTTCTTGGCTTGATGG - Intergenic
1077582850 11:3428030-3428052 CTGCTGGGTTCTTGGAGTGCTGG + Intergenic
1078582022 11:12546148-12546170 CTGCTTTGTTCTAGCCATGCCGG - Intergenic
1079446974 11:20566410-20566432 CTGCTTTATTCTAGCCATGCTGG - Intergenic
1079948651 11:26774045-26774067 CTGCTTTATTCTAGCCATGCTGG + Intergenic
1080098915 11:28436943-28436965 CTGCTTTATTCTAGCCATGCTGG - Intergenic
1080147186 11:29000687-29000709 CTGCTATGTGCTAGGCATTGAGG - Intergenic
1080693155 11:34576452-34576474 CTGCTCTCTTCCTGGAATGCTGG + Intergenic
1083039585 11:59672534-59672556 TTCCCATGTACTTGGCATGCAGG - Intergenic
1083271417 11:61574765-61574787 CTGCTATGTGCCAGCCATGCTGG + Intronic
1085603028 11:77872430-77872452 GTGCTAGGCTCTTGGGATGCAGG + Intronic
1087303533 11:96462683-96462705 CACCTCTTTTCTTGGCATGCAGG + Intronic
1087362958 11:97183951-97183973 CTGCTTTGTTCTAGCCCTGCTGG - Intergenic
1088151467 11:106750281-106750303 CTGCTTTATTCTAGCCATGCTGG + Intronic
1088443168 11:109894557-109894579 CTGCTCTGCTCTTGTTATGCTGG + Intergenic
1088669040 11:112123154-112123176 CTGCTATCTTCTTGGCAGCAGGG - Intronic
1090196957 11:124824798-124824820 CTGCTTTATTCTAGTCATGCTGG + Intergenic
1091207128 11:133829582-133829604 CTGCTCTGTCCCTGCCATGCAGG + Intergenic
1092940737 12:13404819-13404841 CTGCTATGATCCTGCCAGGCGGG - Intergenic
1093740432 12:22679399-22679421 CTGCTTTGTTTTTGCCGTGCTGG + Intronic
1094549047 12:31432762-31432784 ATGCTTTGTTCTTGGCTTGCTGG - Intronic
1095792376 12:46181634-46181656 CTGCTTTGTTCTAGCCATGCTGG - Intergenic
1097403372 12:59157611-59157633 CTGCCACGTCCTTGGCATCCTGG + Intergenic
1099673992 12:85733165-85733187 CTGCTTTGTTCTAGCCATGCTGG - Intergenic
1100384856 12:94096328-94096350 CTACTTTGTTCTAGCCATGCTGG + Intergenic
1101713834 12:107293194-107293216 CTGCTTTATTCTGGCCATGCTGG - Intergenic
1103099691 12:118162564-118162586 CTGCAATGTTCTTAGCTTTCTGG + Intronic
1106026578 13:25960826-25960848 CTTCCTTGTTCCTGGCATGCTGG - Intronic
1106911265 13:34465770-34465792 CTGCTTTATTCTGGCCATGCTGG - Intergenic
1108287937 13:48927315-48927337 CTGCTTTGTTCTAACCATGCTGG - Intergenic
1108925013 13:55731518-55731540 CTGCTTTGTTCTAGTCATGCTGG - Intergenic
1108954891 13:56140782-56140804 CTGCTTTATTCTAGCCATGCTGG + Intergenic
1109214945 13:59579217-59579239 CTTCTATCCTCTTGGAATGCAGG + Intergenic
1112953442 13:105030991-105031013 CTGCTTTTTTCTAGCCATGCTGG + Intergenic
1113218698 13:108073000-108073022 CTGCTTTATTCTAGCCATGCTGG + Intergenic
1115347990 14:32363664-32363686 CTGCTTTATTCTAGCCATGCTGG + Intronic
1115374546 14:32659974-32659996 CTGATGTGCTATTGGCATGCTGG + Intronic
1115391649 14:32860955-32860977 CTGCTTTGTTCTAGCCACGCTGG - Intergenic
1116122696 14:40741067-40741089 CTGCTTTGTTCTAGCCAAGCTGG + Intergenic
1117614085 14:57515267-57515289 TTTCTCTGTTCTTGGCATACAGG + Intergenic
1118862472 14:69675229-69675251 CTGCTTAGTTCTTGGTGTGCAGG + Intronic
1118983448 14:70733790-70733812 CTGCTTTGTTCTAGCCTTGCTGG - Exonic
1119392623 14:74301489-74301511 TTCCTATGTTCCTGGCTTGCAGG - Intronic
1121242019 14:92438014-92438036 CTGCTGAATTCTTGGCATGTGGG - Intronic
1121861712 14:97324819-97324841 CTGCTATGTTCTAAGACTGCTGG + Intergenic
1122267008 14:100551238-100551260 CTGCTAGGGTGTTGGCCTGCTGG + Intronic
1124722351 15:32121100-32121122 CTGCTGAGGTCTTAGCATGCTGG - Intronic
1126892852 15:53224427-53224449 CTGGTAAGTTCTAGGCTTGCTGG + Intergenic
1128382447 15:67122997-67123019 TTGTTATGTTCTTGTTATGCTGG - Intronic
1131260915 15:90887254-90887276 CCGCTATGTGCTGGGCGTGCGGG + Exonic
1131342092 15:91611914-91611936 CTGCTGTGTTCTTCTCATGCAGG - Intergenic
1132632787 16:927970-927992 CTGCTGTGCTCTTGCCAAGCGGG - Intronic
1133351434 16:5103265-5103287 CTGCTGGGTTCTTGGAGTGCTGG + Intergenic
1134397304 16:13876965-13876987 CTGCTTTGTTCTAGCCATGATGG - Intergenic
1134504908 16:14797176-14797198 CTGCTTTATTCTAGCCATGCTGG + Intronic
1134575666 16:15331733-15331755 CTGCTTTATTCTAGCCATGCTGG - Intergenic
1134796744 16:17046092-17046114 CTTGTATGTTCTTGGCATCTTGG + Intergenic
1134940653 16:18287094-18287116 CTGCTTTATTCTAGCCATGCTGG - Intergenic
1135564523 16:23501364-23501386 CTGCAATGTCCTTGGGATTCTGG - Intronic
1135774388 16:25243614-25243636 CAGTGATGTTCTTGGCATGGTGG - Intronic
1137418068 16:48303904-48303926 CTGCTTTATTCTAGCCATGCTGG + Intronic
1139048675 16:63096263-63096285 CTGCTTTCTTCTAGCCATGCTGG - Intergenic
1142807520 17:2379318-2379340 CTGCTAGATTCTTGACATCCCGG - Intronic
1143353480 17:6307013-6307035 CTGCTTTGTTCTAGCCACGCTGG - Intergenic
1145160292 17:20569246-20569268 CTCCTCTGTCCTTGGCCTGCAGG + Intergenic
1145258090 17:21338538-21338560 CTTCTGTGTTCCTGGGATGCTGG + Intergenic
1150167214 17:62955498-62955520 CTGCTTTATTCTAGCCATGCTGG - Intergenic
1151045988 17:70919880-70919902 CTGCTTTGTTCTAGCTATGCTGG + Intergenic
1152434739 17:80269134-80269156 CTGCTTTGTTCTAGCCACGCTGG + Intronic
1152841040 17:82568348-82568370 CTGCTGTGTTCTTGGTATTGGGG + Intronic
1153895856 18:9558967-9558989 CTGCAATGCTCAAGGCATGCAGG + Intronic
1154004693 18:10516984-10517006 CTGCAATGTTTCTGGAATGCAGG + Intergenic
1156177210 18:34560287-34560309 CAGCTATGTTCCTGGCATTATGG - Intronic
1156240894 18:35252811-35252833 CTGCTATGTGCTAGGCATTGAGG - Exonic
1156459990 18:37316223-37316245 CTGCCATGTTCAGGGCAGGCAGG + Intronic
1156860843 18:41834760-41834782 CAGCTAAGTGCTTGGCATACAGG + Intergenic
1157870619 18:51227079-51227101 CTGCTCTATTCTGGCCATGCTGG + Intergenic
1158597498 18:58828839-58828861 CAGCTATGTTCTTGGCAGGTTGG + Intergenic
1158610787 18:58938718-58938740 CCCCTCTGTTCTTGGCATGCAGG + Intronic
1158963027 18:62602024-62602046 CTGCTCTGTTCTCAGCATGGTGG - Intergenic
1159301730 18:66581525-66581547 CTGCTTTGTTCTAGCCATGCTGG - Intronic
1159720826 18:71888290-71888312 CTGCTTTGTTCTAGCCAAGCTGG + Intergenic
1159916537 18:74193516-74193538 CTCCTATATTCTTTACATGCCGG - Intergenic
1161997604 19:7723368-7723390 CTGCTTTGTTCTAGCCACGCTGG - Intergenic
1167180945 19:47903092-47903114 ATGCTGTGTTTGTGGCATGCAGG - Intergenic
926570175 2:14520826-14520848 CTGCTATGTTCTTGTCCCTCTGG - Intergenic
926830668 2:16958647-16958669 CTGATATTCTCTTGGCATGAAGG - Intergenic
927240504 2:20916293-20916315 GTGCAATGTTCCTGGCATGTGGG + Intergenic
929581758 2:43085788-43085810 CTGCTATGCTCCTGGCACCCGGG - Intergenic
929887769 2:45893835-45893857 CTGGTCTGTTCTTTGTATGCTGG + Intronic
931667212 2:64617963-64617985 CTGGTATGTTCTTGGGAGTCTGG + Intergenic
931687721 2:64808788-64808810 CTGCTTTGTTCTAGCCATGCTGG - Intergenic
931808196 2:65828399-65828421 GTGCGGTGTTCTGGGCATGCAGG + Intergenic
932913783 2:75833501-75833523 CTGCTTTGTTTTTGGCTTTCTGG - Intergenic
933163320 2:79050918-79050940 CTGCTTTATTCTAGCCATGCTGG - Intergenic
934315120 2:91910895-91910917 CTGCTTTATTCTAGCCATGCTGG + Intergenic
934955253 2:98612090-98612112 CTCCTGTGTGGTTGGCATGCTGG + Intronic
935613611 2:105052955-105052977 TTGCTATTTTGTTGGCAGGCTGG + Intronic
936807020 2:116347080-116347102 CTGATATGTTCTTAGGAGGCTGG + Intergenic
937962375 2:127470009-127470031 CTTCTATCTTCTTGGGAAGCTGG + Intronic
940420816 2:153477951-153477973 CTGCTACTTACTTGGAATGCGGG - Exonic
940452200 2:153853198-153853220 CTGCTTTATTCTAGACATGCTGG + Intergenic
941591168 2:167422294-167422316 GGGCTCTGTTCTTGGCTTGCAGG - Intergenic
942279365 2:174344355-174344377 CTGCTACATTCTGGGCATTCTGG + Intergenic
942490511 2:176485203-176485225 CTGCAGTGTTCTTGGCAACCTGG + Intergenic
942837130 2:180313959-180313981 CTGCTTTGTTCTAGCCATGCTGG + Intergenic
942837312 2:180315683-180315705 CTGCTTTGATCTAGCCATGCTGG - Intergenic
943089195 2:183353758-183353780 CTGCTAAGTTCTGGGCACGGGGG + Intergenic
943922679 2:193729529-193729551 CTGCTTTATTCTAGCCATGCTGG - Intergenic
943994255 2:194738886-194738908 TTGCTTTGTTCTAGCCATGCTGG - Intergenic
945006727 2:205416556-205416578 CTGCTAAGCCCTTGGCCTGCAGG + Intronic
945605226 2:211921299-211921321 CTGTTATGTTCATGGAATGAGGG - Intronic
945630996 2:212276206-212276228 CTACTATGTTCTAGGCATTCTGG - Intronic
945835181 2:214831149-214831171 CTACTATATACTAGGCATGCTGG - Intergenic
946031444 2:216708299-216708321 CAGCTCTGTGCCTGGCATGCAGG + Intergenic
946643112 2:221805171-221805193 CTGCTTTGTTCTAGCCATGCTGG + Intergenic
946815802 2:223577574-223577596 CTGCACTGCTCTTGGCAAGCAGG + Intergenic
948632537 2:239311268-239311290 CTGCTGTGTCACTGGCATGCTGG + Intronic
1170093252 20:12616594-12616616 CTGCCCTTTCCTTGGCATGCAGG - Intergenic
1170769268 20:19318005-19318027 CTGCTTTGTGCATGGCAGGCTGG + Intronic
1170870028 20:20197124-20197146 CTGAAATGTTCTTGGCTTGAAGG - Intronic
1171796506 20:29570559-29570581 CTACTTTGTTCTTGCCATTCTGG - Intergenic
1173492648 20:43495670-43495692 CTGCTTTGTTCTAGCTATGCTGG + Intergenic
1174784120 20:53416697-53416719 CTACTATGTTCTCAGCATGATGG - Intronic
1175848520 20:62073134-62073156 CTGCTTTATTCTAGCCATGCTGG - Intergenic
1178767259 21:35466141-35466163 CTGCTTTGTTCTAGCCATGTTGG - Intronic
1179976388 21:44870114-44870136 CCGCTCTGTTCTTGGCCTGCTGG - Intronic
1180541880 22:16456779-16456801 CTGCTTTATTCTAGCCATGCTGG + Intergenic
1180611453 22:17100768-17100790 ATGCTATTTTCTGGGCAGGCTGG - Intronic
1180971390 22:19817930-19817952 CAGGTGTGTCCTTGGCATGCGGG + Intronic
1182106949 22:27696430-27696452 CTGCTCTGTACATGCCATGCTGG + Intergenic
1182736502 22:32535006-32535028 CTGGTATGTTCCAGGCATTCTGG + Intronic
1182813872 22:33140551-33140573 CTGCTGTATTCTAGCCATGCTGG - Intergenic
949837283 3:8282709-8282731 TTGCTATGTGCCAGGCATGCAGG - Intergenic
950311499 3:11962360-11962382 CAGTTATGATCTTGGGATGCTGG - Intergenic
951999585 3:28770733-28770755 CTGCTTTGTTCTAGCCATGCTGG - Intergenic
953453343 3:43021994-43022016 CTGCAATGTTCATGGCAGGAGGG - Intronic
954737722 3:52720234-52720256 CTCCTGGGTTCTTGGCATGGTGG - Intronic
955724842 3:61922328-61922350 GTGCTAAATGCTTGGCATGCAGG + Intronic
956898042 3:73683901-73683923 CTGCTTTGTTCTTGCTGTGCTGG + Intergenic
957495843 3:80990633-80990655 CTGCTTTGTTCTAGCCATGCTGG - Intergenic
959339642 3:105112782-105112804 CTGCTCTATTCTAGCCATGCTGG + Intergenic
959813779 3:110651624-110651646 GTGCCCTGTTCTTGGCATGCTGG + Intergenic
960823463 3:121758371-121758393 CTGCTATCTTTTAGGCATCCTGG - Intergenic
961733399 3:128984364-128984386 CTGCTTTCTTCTAGCCATGCTGG - Intronic
967308951 3:188087905-188087927 CACCTGTGTTCTTTGCATGCTGG - Intergenic
969522602 4:7687280-7687302 CTGCTGTGATCTTGGTAGGCAGG - Intronic
969721879 4:8896484-8896506 CTGCTGTGTTCTAGGGATGGAGG + Intergenic
969815841 4:9686914-9686936 CTGCTGGGTTCTTGGAGTGCTGG - Intergenic
970539149 4:17060000-17060022 CTACTATGTACCAGGCATGCTGG + Intergenic
970579563 4:17462866-17462888 CTACTATGTGCTGGGCATGATGG - Intronic
970587676 4:17530127-17530149 CTGCTCCCTTCTTGGCATGATGG - Intergenic
970644761 4:18107445-18107467 CTGCTTTGTTCTAGCCATGCTGG + Intergenic
970729811 4:19089563-19089585 CTGCTTTGTTCTAGCCTTGCTGG - Intergenic
970787917 4:19822014-19822036 CTGCTTTGTTCTAGCCATGCTGG - Intergenic
970812371 4:20109522-20109544 CTGCTGTATTCTTGTCATCCAGG + Intergenic
971078879 4:23183890-23183912 CTGGTTTGTTCTAGCCATGCTGG + Intergenic
971824525 4:31604120-31604142 CTGTTTTGTTCTAGCCATGCTGG + Intergenic
971981991 4:33763555-33763577 CTGTTTTGTTCTAGCCATGCTGG - Intergenic
973367973 4:49222900-49222922 CTGCTGTGTTTTTGACTTGCAGG - Intergenic
974203108 4:58666350-58666372 CTGCTTTTTTCTAGGCATGCTGG + Intergenic
975024798 4:69534753-69534775 CTGCTATGGTCTAGCCATGCTGG - Intergenic
975720537 4:77244708-77244730 CTGCTTTCTTCTAGCCATGCTGG + Intronic
975875199 4:78828107-78828129 CTGCTTTATTCTAGCCATGCTGG - Intronic
977809259 4:101340359-101340381 ATGCTATGTTTTTGGAATTCAGG - Intronic
977947362 4:102928985-102929007 CTGCTTTATTCTAGCCATGCTGG + Intronic
978850827 4:113334022-113334044 TTGGTATGTTCCTGGCATGCAGG - Intronic
979888267 4:126059629-126059651 CTGCTTTGTTCTAGCCATGCTGG + Intergenic
980052609 4:128053419-128053441 CTGCTTTATTCTAGCCATGCTGG + Intergenic
981135546 4:141207037-141207059 CTGCTTTGTTCTAGCCATGCTGG + Intronic
982606398 4:157521757-157521779 CTGCTTTATTCTAGCCATGCTGG + Intergenic
984860460 4:184233095-184233117 CTGCTTTATTCTAGCCATGCTGG - Intergenic
986677261 5:10196983-10197005 CTACTTTGTTCTAGTCATGCTGG - Intergenic
986702413 5:10423752-10423774 CTGCAATGATTTTGGCATGCAGG - Exonic
986760742 5:10877435-10877457 CTGCTGTGTTCTAGCCAGGCTGG + Intergenic
987662031 5:20889761-20889783 CTGCTTTGTTCTAGCCGTGCTGG + Intergenic
987700989 5:21398178-21398200 CTGCTTTATTCTAGCCATGCTGG - Intergenic
987999892 5:25334609-25334631 CTGCTTTATTCTAGCCATGCTGG - Intergenic
988209370 5:28183541-28183563 CTGCTTTGTTCTAGACATGCTGG + Intergenic
989071190 5:37513438-37513460 CTGGTATGTGCTGGGCATGAGGG + Intronic
989754781 5:44939561-44939583 CTGCTTTGTTCTAGCCGTGCTGG - Intergenic
990931092 5:61093163-61093185 CTGCTTTATTCTAGCCATGCTGG + Intronic
991537614 5:67689642-67689664 GTTCAATGATCTTGGCATGCTGG - Intergenic
992500192 5:77334510-77334532 GTGCAATGTGCTAGGCATGCCGG + Intronic
992769320 5:80032743-80032765 CTGCTTTATTCTAGCCATGCTGG + Intronic
993865575 5:93190686-93190708 CTGCTATCTTATTGCTATGCTGG - Intergenic
995187156 5:109283518-109283540 CTGCTTTATTCTAGCCATGCTGG + Intergenic
995790930 5:115885552-115885574 CTGCTTTGTTCTAGCCACGCTGG + Intronic
995861438 5:116644869-116644891 CTGCTTTGTTCTAGTCACGCTGG + Intergenic
995979704 5:118086802-118086824 CTGCTTTGTTTTAGCCATGCTGG + Intergenic
996223237 5:120958941-120958963 CTGCTTTGTTCTAGCCACGCTGG - Intergenic
996555953 5:124779015-124779037 CTGCTTTGTTCTAGCTATGCTGG - Intergenic
997885277 5:137624715-137624737 CTGGTATGTTCTGTGCATGCTGG + Intronic
999805571 5:155077971-155077993 CTGCTTTGTTCTAGCCATGCTGG + Intergenic
999890749 5:155976475-155976497 GTGTTACGTTCTTGGTATGCTGG - Intronic
1001532631 5:172474842-172474864 GTGCTATGTGCCTGGCATGATGG + Intergenic
1002645993 5:180655180-180655202 CTGCTTTGTTCTAGCCGTGCTGG - Intergenic
1003218159 6:4134378-4134400 CTGCTCTGTTCCTGGCTGGCTGG - Intronic
1003978866 6:11370739-11370761 CTGCTGTGTTCTTGGCACATGGG - Intronic
1005265695 6:24109937-24109959 CTGCTTTATTCTAGCCATGCTGG + Intergenic
1005988424 6:30888915-30888937 CCGCTATGCCCTGGGCATGCAGG + Exonic
1006976659 6:38108647-38108669 CTGCTGTGTTCTGGCCATCCTGG + Intronic
1007210464 6:40189756-40189778 ATGCTGTGTTCTGGGCATGGTGG + Intergenic
1010326665 6:74571118-74571140 CTGCTTTGTTCTAGCCATACTGG + Intergenic
1011328004 6:86172350-86172372 CTGCTTTATTCTAGCCATGCTGG - Intergenic
1011847180 6:91580583-91580605 CTGCTTTATTCTAGCCATGCTGG + Intergenic
1012001498 6:93660784-93660806 CTGCTTTGTTCTAGCCAGGCTGG - Intergenic
1012577403 6:100819718-100819740 CTGCTTTATTCTAGCCATGCTGG + Intronic
1012750793 6:103161025-103161047 CTGCTGTGTTTTTGCCATGCTGG - Intergenic
1013416733 6:109932238-109932260 CTGCTTTGTTCTAGCCATGCGGG + Intergenic
1013927243 6:115488059-115488081 CTGCTTTGTTCTTACCCTGCTGG - Intergenic
1014672304 6:124320683-124320705 TTGCTACATTCTTGCCATGCTGG - Intronic
1014851413 6:126343754-126343776 CTGCTTTATTCTAGCCATGCTGG + Intronic
1015256023 6:131180255-131180277 CAGCTGTGTTCTTGGTCTGCTGG + Intronic
1015528476 6:134196618-134196640 CTGCTCTGTGCATGGCCTGCTGG + Intronic
1016508745 6:144815681-144815703 CTGCTTTGTTCTAGCCATACTGG + Intronic
1016534769 6:145097797-145097819 CTGCCATCTTCTTGGTTTGCTGG + Intergenic
1016859903 6:148707165-148707187 CTGCTTTATTCTAGCCATGCTGG + Intergenic
1016868889 6:148797497-148797519 CTGCTATGTGCTAGGCATTGTGG + Intronic
1016938018 6:149462685-149462707 CTGTTTTGTTCTAGCCATGCTGG - Intronic
1017632940 6:156416470-156416492 CTGCTATGTGCCAGGCATGAAGG + Intergenic
1018752971 6:166823181-166823203 CTGCAGTGTTCTGGGCATTCTGG - Intronic
1018936156 6:168275277-168275299 ATGCTGTGTTCCTGGCACGCAGG - Intergenic
1019621745 7:1995835-1995857 GTGCTTCGTGCTTGGCATGCTGG - Intronic
1020742878 7:12043948-12043970 CTGCTTTATTCTAGCCATGCTGG + Intergenic
1021355105 7:19644591-19644613 ATGCTTTGTTCTAGCCATGCTGG - Intergenic
1021380287 7:19957936-19957958 CTTATATCTTCTTGGCATACTGG - Intergenic
1023694108 7:42826930-42826952 ATGCTATGTTCTTGGCAAGCTGG - Intergenic
1025025629 7:55514157-55514179 TTGCTTTGTACTTGGCAAGCAGG + Intronic
1026192753 7:68144519-68144541 CTGTTTTGTTCTAGCCATGCTGG - Intergenic
1027692852 7:81369913-81369935 CTGCTTTGTTCTAGCCACGCCGG - Intergenic
1027699815 7:81456036-81456058 CTACTTTATTCTTGCCATGCTGG - Intergenic
1028928496 7:96386859-96386881 CTGTTTTGTTCTTGGCTTTCTGG + Intergenic
1029206455 7:98871831-98871853 CTGCTATGTTCAGGGAATGGAGG + Intergenic
1029806382 7:103001605-103001627 CTGCTTTGTTCTAGCTATGCTGG - Intronic
1031690404 7:124781197-124781219 CTGCTTTATTCTAGCCATGCTGG + Intronic
1031915787 7:127561764-127561786 CTGCTTTGTTCTAGCCATACTGG + Intergenic
1032797744 7:135291101-135291123 CTGTTATGTTTCTGGCATGATGG - Intergenic
1032890606 7:136191130-136191152 CTGCTTTATTCTAGCCATGCTGG + Intergenic
1033463225 7:141566348-141566370 CTTCTATGTACTGGGCCTGCAGG - Intronic
1035061101 7:156070298-156070320 CTGCTTCGTTCTGGCCATGCTGG + Intergenic
1038562768 8:28595142-28595164 CTGCTTTGTGCTTGGCTTCCAGG - Intergenic
1038919258 8:32064516-32064538 CTGCTCTGTGCTGTGCATGCTGG - Intronic
1040780458 8:51101639-51101661 CTGCTTTATTCTAGCCATGCTGG + Intergenic
1040793824 8:51267871-51267893 CTGCTTTATTCTAGCCATGCTGG + Intergenic
1041528126 8:58831714-58831736 CTACTATGTTCCAAGCATGCTGG - Intronic
1041943612 8:63417104-63417126 TTGCTGTGTTCTTAGCATGCTGG + Intergenic
1043662034 8:82755552-82755574 CTGCTTTGTTCTAACCATGCTGG - Intergenic
1044344669 8:91091526-91091548 CTGCTTTATTCTAGCCATGCTGG - Intergenic
1044633878 8:94303364-94303386 CTGCTTTATTCTAGCCATGCTGG + Intergenic
1044720049 8:95136131-95136153 CTGCTATGTTCTTGGCATGCAGG - Intronic
1045393706 8:101739553-101739575 CTGCTTTATTCTAGCCATGCTGG - Intronic
1045405190 8:101859114-101859136 CTGCTTTATTCTAGCCATGCTGG - Intronic
1046381198 8:113453183-113453205 CTGCTTTGTTTTAGCCATGCTGG - Intergenic
1046734984 8:117767375-117767397 CTGTTATGTTCATTCCATGCAGG - Intergenic
1048644172 8:136399646-136399668 CTGCTTTCTTCTGGCCATGCTGG - Intergenic
1048908397 8:139110653-139110675 CTGCTTTGTTTTAGCCATGCTGG + Intergenic
1050186097 9:2975550-2975572 CTGCTTTATTCTAGCCATGCTGG + Intergenic
1051299706 9:15635524-15635546 CTGCTTTATTCTAGCCATGCTGG + Intronic
1052420275 9:28234546-28234568 CTGCTTTATTCTAGCCATGCTGG - Intronic
1055688891 9:78808680-78808702 CTGCTATGTGCTGGACATGTTGG + Intergenic
1055752408 9:79521550-79521572 CTGCTTTGTTCGTGCCATGATGG + Intergenic
1055878079 9:80967037-80967059 CTGCTTTATTCTAGCCATGCTGG - Intergenic
1055882958 9:81023901-81023923 CTGCTCTGTTCTAGCCACGCTGG - Intergenic
1059547314 9:115190883-115190905 CAGCTTTGTTCTTGTCATTCAGG - Intronic
1185575702 X:1170486-1170508 CTGCTACATTCTTAGCATGCTGG - Intergenic
1185920242 X:4083462-4083484 CTGCTTTGTTCTAGCTATGCTGG + Intergenic
1186288226 X:8068755-8068777 CTGCTTTCTTCTAGCCATGCAGG - Intergenic
1187840206 X:23479201-23479223 CTGCTTTGTTCTAGCCGTGCTGG - Intergenic
1188982278 X:36737327-36737349 CTGCTTTGTTCTGGCCATGCTGG - Intergenic
1189785715 X:44557193-44557215 CTGCTTTGTTCTAGTCATGCTGG + Intergenic
1190169641 X:48101756-48101778 CTGCTTTGTTCTAGCCACGCTGG + Intergenic
1190311134 X:49117693-49117715 CTCATCTGGTCTTGGCATGCGGG + Exonic
1190402714 X:50054791-50054813 CTTCTAAGTTCTTTGCTTGCAGG + Intronic
1191013366 X:55784561-55784583 CTGCTTTGTTCTAGCCATGCCGG + Intergenic
1192218604 X:69181223-69181245 CTGCTGTGCTCCTGGCAGGCAGG + Intergenic
1192661276 X:73045267-73045289 CTGCTTTGTTCTGGCCATGCTGG + Intergenic
1192827971 X:74718425-74718447 CTGATTTGTTCTAGCCATGCTGG - Intergenic
1193091916 X:77502686-77502708 CTGCTTTGTTATTGGCATGTGGG + Intergenic
1193520418 X:82523111-82523133 CAGCTGTGTTCTTGGCAGGTGGG + Intergenic
1193565057 X:83065827-83065849 CTGCTTTGTTCTTGCCATTCTGG + Intergenic
1193792916 X:85838187-85838209 CTGCTTTATTCTAGCCATGCTGG + Intergenic
1194265341 X:91746226-91746248 CTGCTATGTTCTACTCATGATGG - Intergenic
1194573496 X:95582184-95582206 CTCCTGTGTTCTTGGCATGTAGG - Intergenic
1195164941 X:102210054-102210076 CTGCTTTGTTCTAGCCATGCTGG - Intergenic
1195193917 X:102477037-102477059 CTGCTTTGTTCTAGCCATGCTGG + Intergenic
1195537330 X:106023597-106023619 CTGCTATTTCCTTTCCATGCTGG - Intergenic
1196772316 X:119307425-119307447 CTGCTTTATTCTAGCCATGCTGG - Intergenic
1197084661 X:122457168-122457190 CTGCTTTATTCTAGCCATGCTGG + Intergenic
1197426930 X:126308201-126308223 CTGCTTTGTTCTAGCTATGCCGG + Intergenic
1198047418 X:132916586-132916608 CTGCTTTGTTCTAGCCACGCTGG - Intronic
1199287051 X:146065214-146065236 CTGCTTTGTTCTAGCCACGCTGG - Intergenic
1199418912 X:147620179-147620201 CTGCTTTATTCTAGCCATGCTGG - Intergenic
1199676225 X:150191382-150191404 TTACAATATTCTTGGCATGCAGG - Intergenic
1200582492 Y:4966688-4966710 CTGCTATGTTCTACTCATGATGG - Intergenic
1201182791 Y:11365705-11365727 CTGCTTTATTCTAGCCATGCTGG + Intergenic
1201437905 Y:13979207-13979229 CTGATTTGTTCTAGCCATGCTGG + Intergenic