ID: 1044727042

View in Genome Browser
Species Human (GRCh38)
Location 8:95202434-95202456
Sequence TATATAGGGTTCAGTACTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044727042_1044727046 26 Left 1044727042 8:95202434-95202456 CCAAGAGTACTGAACCCTATATA No data
Right 1044727046 8:95202483-95202505 TTCTTTTTTTTAATAGAGATAGG No data
1044727042_1044727047 27 Left 1044727042 8:95202434-95202456 CCAAGAGTACTGAACCCTATATA No data
Right 1044727047 8:95202484-95202506 TCTTTTTTTTAATAGAGATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044727042 Original CRISPR TATATAGGGTTCAGTACTCT TGG (reversed) Intergenic
No off target data available for this crispr