ID: 1044727665

View in Genome Browser
Species Human (GRCh38)
Location 8:95206632-95206654
Sequence CTGTTGGGAAGGAGGAAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044727665_1044727672 7 Left 1044727665 8:95206632-95206654 CCCTCTTTCCTCCTTCCCAACAG No data
Right 1044727672 8:95206662-95206684 TTCTCCTTGACATAAGTGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044727665 Original CRISPR CTGTTGGGAAGGAGGAAAGA GGG (reversed) Intergenic
No off target data available for this crispr