ID: 1044729892

View in Genome Browser
Species Human (GRCh38)
Location 8:95221224-95221246
Sequence CTGGGCAAAGGCTCCTACTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044729882_1044729892 22 Left 1044729882 8:95221179-95221201 CCCACCCTTTCCTCTCTGGCTTC No data
Right 1044729892 8:95221224-95221246 CTGGGCAAAGGCTCCTACTTAGG No data
1044729886_1044729892 12 Left 1044729886 8:95221189-95221211 CCTCTCTGGCTTCTGCTCTCACG No data
Right 1044729892 8:95221224-95221246 CTGGGCAAAGGCTCCTACTTAGG No data
1044729883_1044729892 21 Left 1044729883 8:95221180-95221202 CCACCCTTTCCTCTCTGGCTTCT No data
Right 1044729892 8:95221224-95221246 CTGGGCAAAGGCTCCTACTTAGG No data
1044729884_1044729892 18 Left 1044729884 8:95221183-95221205 CCCTTTCCTCTCTGGCTTCTGCT No data
Right 1044729892 8:95221224-95221246 CTGGGCAAAGGCTCCTACTTAGG No data
1044729885_1044729892 17 Left 1044729885 8:95221184-95221206 CCTTTCCTCTCTGGCTTCTGCTC No data
Right 1044729892 8:95221224-95221246 CTGGGCAAAGGCTCCTACTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044729892 Original CRISPR CTGGGCAAAGGCTCCTACTT AGG Intergenic
No off target data available for this crispr