ID: 1044730662

View in Genome Browser
Species Human (GRCh38)
Location 8:95226322-95226344
Sequence GAGGATGCACAACCTGATCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044730659_1044730662 -3 Left 1044730659 8:95226302-95226324 CCAAATCACCTAGGGATCTGGAG No data
Right 1044730662 8:95226322-95226344 GAGGATGCACAACCTGATCCAGG No data
1044730655_1044730662 29 Left 1044730655 8:95226270-95226292 CCTGCAGACTCAGTGTTTCTCAA No data
Right 1044730662 8:95226322-95226344 GAGGATGCACAACCTGATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044730662 Original CRISPR GAGGATGCACAACCTGATCC AGG Intergenic
No off target data available for this crispr