ID: 1044734874

View in Genome Browser
Species Human (GRCh38)
Location 8:95269018-95269040
Sequence GCTCAGGTTAACCGGGCGGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 51
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 48}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044734874_1044734884 16 Left 1044734874 8:95269018-95269040 CCTCCCGCCCGGTTAACCTGAGC 0: 1
1: 0
2: 0
3: 2
4: 48
Right 1044734884 8:95269057-95269079 CTTGGTTCCGGTCGCTACTGTGG 0: 1
1: 0
2: 0
3: 3
4: 24
1044734874_1044734881 -2 Left 1044734874 8:95269018-95269040 CCTCCCGCCCGGTTAACCTGAGC 0: 1
1: 0
2: 0
3: 2
4: 48
Right 1044734881 8:95269039-95269061 GCGTCTCTTTCGCCTTGGCTTGG 0: 1
1: 0
2: 0
3: 5
4: 106
1044734874_1044734885 17 Left 1044734874 8:95269018-95269040 CCTCCCGCCCGGTTAACCTGAGC 0: 1
1: 0
2: 0
3: 2
4: 48
Right 1044734885 8:95269058-95269080 TTGGTTCCGGTCGCTACTGTGGG 0: 1
1: 0
2: 1
3: 1
4: 13
1044734874_1044734882 4 Left 1044734874 8:95269018-95269040 CCTCCCGCCCGGTTAACCTGAGC 0: 1
1: 0
2: 0
3: 2
4: 48
Right 1044734882 8:95269045-95269067 CTTTCGCCTTGGCTTGGTTCCGG 0: 1
1: 0
2: 0
3: 3
4: 83
1044734874_1044734880 -7 Left 1044734874 8:95269018-95269040 CCTCCCGCCCGGTTAACCTGAGC 0: 1
1: 0
2: 0
3: 2
4: 48
Right 1044734880 8:95269034-95269056 CCTGAGCGTCTCTTTCGCCTTGG 0: 1
1: 0
2: 0
3: 2
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044734874 Original CRISPR GCTCAGGTTAACCGGGCGGG AGG (reversed) Exonic
901056177 1:6449528-6449550 GCTCAGGATAGACGGGCAGGGGG - Intronic
901666539 1:10829444-10829466 GCTCAGCTGGTCCGGGCGGGTGG - Intergenic
903015828 1:20361340-20361362 GCTCAGGTTTCCCGGGGCGGGGG - Intergenic
914730250 1:150363880-150363902 ACTAAGGTTAGCCGGGTGGGGGG - Intronic
916548279 1:165827426-165827448 GAAAGGGTTAACCGGGCGGGTGG + Intronic
918470028 1:184862188-184862210 GCTGCTGTTAACCGGGCAGGGGG - Intronic
920920379 1:210293092-210293114 GCTCAAGTTCACTGGGCGGCTGG + Intergenic
922196654 1:223364779-223364801 GCTCAAGTTAACCGGGTCTGTGG - Intergenic
1068617741 10:59138206-59138228 GCTCAAGTGCACGGGGCGGGCGG + Intergenic
1069953463 10:72035511-72035533 GCTGAGGTTAAACTGGCAGGAGG - Intergenic
1070814822 10:79316592-79316614 GCAGAGGGTAACAGGGCGGGGGG - Intergenic
1074470095 10:113719215-113719237 GATCAGGTCACACGGGCGGGTGG + Intronic
1076107021 10:127831730-127831752 GCTCAGGGTTACAGGGCTGGAGG + Intergenic
1083291904 11:61695190-61695212 GCTCTGGGGAACCGGGTGGGAGG + Intronic
1089365203 11:117917242-117917264 GCCCAAGTTCACCTGGCGGGAGG - Exonic
1096808801 12:54156800-54156822 GCTCTGGTGATCCAGGCGGGAGG + Intergenic
1105389466 13:19960281-19960303 GCTCACGTTACCCGGGAGGAGGG + Intronic
1106072309 13:26424489-26424511 GCTCAGCTTACCCGTGCGGGTGG - Intergenic
1112500320 13:99938220-99938242 GCTGAGGTTGGCCGGGCGCGTGG - Intergenic
1118063229 14:62163518-62163540 TCTCAGGTCAACCTGGCAGGGGG + Intergenic
1127328402 15:57916786-57916808 ACCCAGGTTAACCGGGCAGCTGG - Intergenic
1135429832 16:22374095-22374117 GCTCAGGCTCACCTGGCGGCTGG - Intronic
1136546429 16:30957626-30957648 ACGCAGATTCACCGGGCGGGCGG - Exonic
1140970714 16:80009846-80009868 TCTCAGGTTAAGCTGGCTGGAGG - Intergenic
1151718669 17:75843968-75843990 GGTCAGGCCAACCGGGAGGGAGG + Intronic
1160841248 19:1147885-1147907 CCTCAGGGTGACAGGGCGGGGGG - Intronic
1166817140 19:45553155-45553177 GATCAGGTAAACCGGGGGTGGGG + Intronic
1167721965 19:51185485-51185507 GGTCAGGTTTCCCGGGCGGCCGG - Intergenic
932846696 2:75142693-75142715 GGTCAGGTTAACCAGCTGGGAGG + Intronic
934688039 2:96335843-96335865 GCCCAGGTGAGCCGGGCGGTCGG + Exonic
937336011 2:121062728-121062750 GCTCGGGTTATCCGAGTGGGCGG - Intergenic
937931159 2:127205981-127206003 GCTCAGGTGCTCCGGGCGGAGGG - Intronic
947749602 2:232525486-232525508 GCTCAGGGTTGCCTGGCGGGGGG - Exonic
948944941 2:241214769-241214791 GCTCAGGTTAGCTGGGAGAGGGG - Intronic
1170869789 20:20195142-20195164 GCTCAGGGTAACCGGGCCAGTGG - Intronic
1180003106 21:45003973-45003995 GGTCAGGTTATCCAGGTGGGAGG + Intergenic
1184931956 22:47687942-47687964 TCTCAGGTTATCCGGGGGTGGGG - Intergenic
973632641 4:52833800-52833822 GCTCTTGTTAATCAGGCGGGGGG + Intergenic
982712176 4:158768865-158768887 GCTCACGTAACCCCGGCGGGAGG - Intergenic
992431457 5:76715352-76715374 GCGCAGGTGACCCCGGCGGGCGG + Intergenic
995530254 5:113085215-113085237 GCTGGGGTTAATCGGGCGGTTGG + Exonic
996101862 5:119452587-119452609 GCTGAGGTTCGACGGGCGGGTGG + Exonic
999391816 5:151198919-151198941 GCCCAGGTGAACTGGGCAGGTGG + Intronic
1001001973 5:168016013-168016035 GCTCAGGTTAACAGTGCAGAAGG - Intronic
1005056241 6:21731429-21731451 GCTCAAGGTAACCCAGCGGGTGG + Intergenic
1007259880 6:40556079-40556101 GCTCAGGTGGACTGGGTGGGTGG - Intronic
1020292087 7:6730000-6730022 GGCCAGGGGAACCGGGCGGGAGG + Intergenic
1044734874 8:95269018-95269040 GCTCAGGTTAACCGGGCGGGAGG - Exonic
1044820020 8:96149850-96149872 GCTCAGGTTCCCCGGGCGTCTGG - Intronic
1048513448 8:135082564-135082586 GTTCAGGTTGTCCGGGTGGGAGG - Intergenic
1062352719 9:136147183-136147205 GCTCAGGTTACCCGGTCTGCAGG + Intergenic