ID: 1044738664

View in Genome Browser
Species Human (GRCh38)
Location 8:95303926-95303948
Sequence TTTCCTCAGCGCAGGCTCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044738661_1044738664 -10 Left 1044738661 8:95303913-95303935 CCAAGCTTTTCCTTTTCCTCAGC No data
Right 1044738664 8:95303926-95303948 TTTCCTCAGCGCAGGCTCTCTGG No data
1044738660_1044738664 15 Left 1044738660 8:95303888-95303910 CCGTGGTTGCAAAGTTCGGGTGA No data
Right 1044738664 8:95303926-95303948 TTTCCTCAGCGCAGGCTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044738664 Original CRISPR TTTCCTCAGCGCAGGCTCTC TGG Intergenic
No off target data available for this crispr