ID: 1044739034

View in Genome Browser
Species Human (GRCh38)
Location 8:95306633-95306655
Sequence GTGGGTATATAAAGACCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044739034_1044739041 30 Left 1044739034 8:95306633-95306655 CCCAGAGGTCTTTATATACCCAC No data
Right 1044739041 8:95306686-95306708 TTGACATCAGCTCCAATCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044739034 Original CRISPR GTGGGTATATAAAGACCTCT GGG (reversed) Intergenic
No off target data available for this crispr