ID: 1044739041

View in Genome Browser
Species Human (GRCh38)
Location 8:95306686-95306708
Sequence TTGACATCAGCTCCAATCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044739039_1044739041 4 Left 1044739039 8:95306659-95306681 CCCAAGATTGTAAAAGTCTATGA No data
Right 1044739041 8:95306686-95306708 TTGACATCAGCTCCAATCCAAGG No data
1044739037_1044739041 11 Left 1044739037 8:95306652-95306674 CCACCAACCCAAGATTGTAAAAG No data
Right 1044739041 8:95306686-95306708 TTGACATCAGCTCCAATCCAAGG No data
1044739036_1044739041 12 Left 1044739036 8:95306651-95306673 CCCACCAACCCAAGATTGTAAAA No data
Right 1044739041 8:95306686-95306708 TTGACATCAGCTCCAATCCAAGG No data
1044739035_1044739041 29 Left 1044739035 8:95306634-95306656 CCAGAGGTCTTTATATACCCACC No data
Right 1044739041 8:95306686-95306708 TTGACATCAGCTCCAATCCAAGG No data
1044739040_1044739041 3 Left 1044739040 8:95306660-95306682 CCAAGATTGTAAAAGTCTATGAA No data
Right 1044739041 8:95306686-95306708 TTGACATCAGCTCCAATCCAAGG No data
1044739038_1044739041 8 Left 1044739038 8:95306655-95306677 CCAACCCAAGATTGTAAAAGTCT No data
Right 1044739041 8:95306686-95306708 TTGACATCAGCTCCAATCCAAGG No data
1044739034_1044739041 30 Left 1044739034 8:95306633-95306655 CCCAGAGGTCTTTATATACCCAC No data
Right 1044739041 8:95306686-95306708 TTGACATCAGCTCCAATCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044739041 Original CRISPR TTGACATCAGCTCCAATCCA AGG Intergenic
No off target data available for this crispr