ID: 1044744303

View in Genome Browser
Species Human (GRCh38)
Location 8:95357378-95357400
Sequence CTGCCTTTCGGCTCCTTCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044744294_1044744303 16 Left 1044744294 8:95357339-95357361 CCGTTAACCCTGAACTTCAGTGA No data
Right 1044744303 8:95357378-95357400 CTGCCTTTCGGCTCCTTCTGGGG No data
1044744299_1044744303 -8 Left 1044744299 8:95357363-95357385 CCATGTAACTCTGGGCTGCCTTT No data
Right 1044744303 8:95357378-95357400 CTGCCTTTCGGCTCCTTCTGGGG No data
1044744295_1044744303 9 Left 1044744295 8:95357346-95357368 CCCTGAACTTCAGTGAGCCATGT No data
Right 1044744303 8:95357378-95357400 CTGCCTTTCGGCTCCTTCTGGGG No data
1044744296_1044744303 8 Left 1044744296 8:95357347-95357369 CCTGAACTTCAGTGAGCCATGTA No data
Right 1044744303 8:95357378-95357400 CTGCCTTTCGGCTCCTTCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044744303 Original CRISPR CTGCCTTTCGGCTCCTTCTG GGG Intergenic
No off target data available for this crispr