ID: 1044748376

View in Genome Browser
Species Human (GRCh38)
Location 8:95393359-95393381
Sequence CTGCATATTCTGAAGGTATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044748376_1044748381 14 Left 1044748376 8:95393359-95393381 CCTTATACCTTCAGAATATGCAG No data
Right 1044748381 8:95393396-95393418 CTTTCAGGCTGTTCTTTTCTAGG No data
1044748376_1044748380 -1 Left 1044748376 8:95393359-95393381 CCTTATACCTTCAGAATATGCAG No data
Right 1044748380 8:95393381-95393403 GGGAATAAGAAGAAACTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044748376 Original CRISPR CTGCATATTCTGAAGGTATA AGG (reversed) Intergenic
No off target data available for this crispr