ID: 1044748381

View in Genome Browser
Species Human (GRCh38)
Location 8:95393396-95393418
Sequence CTTTCAGGCTGTTCTTTTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044748379_1044748381 7 Left 1044748379 8:95393366-95393388 CCTTCAGAATATGCAGGGAATAA No data
Right 1044748381 8:95393396-95393418 CTTTCAGGCTGTTCTTTTCTAGG No data
1044748375_1044748381 15 Left 1044748375 8:95393358-95393380 CCCTTATACCTTCAGAATATGCA No data
Right 1044748381 8:95393396-95393418 CTTTCAGGCTGTTCTTTTCTAGG No data
1044748373_1044748381 24 Left 1044748373 8:95393349-95393371 CCATTTTTCCCCTTATACCTTCA No data
Right 1044748381 8:95393396-95393418 CTTTCAGGCTGTTCTTTTCTAGG No data
1044748374_1044748381 16 Left 1044748374 8:95393357-95393379 CCCCTTATACCTTCAGAATATGC No data
Right 1044748381 8:95393396-95393418 CTTTCAGGCTGTTCTTTTCTAGG No data
1044748376_1044748381 14 Left 1044748376 8:95393359-95393381 CCTTATACCTTCAGAATATGCAG No data
Right 1044748381 8:95393396-95393418 CTTTCAGGCTGTTCTTTTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044748381 Original CRISPR CTTTCAGGCTGTTCTTTTCT AGG Intergenic
No off target data available for this crispr