ID: 1044751142

View in Genome Browser
Species Human (GRCh38)
Location 8:95416738-95416760
Sequence TCAGCTACTCACCTTCAAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044751142_1044751147 28 Left 1044751142 8:95416738-95416760 CCTATTTGAAGGTGAGTAGCTGA No data
Right 1044751147 8:95416789-95416811 TGGTGTGTTTCCTATCCCTAAGG No data
1044751142_1044751144 8 Left 1044751142 8:95416738-95416760 CCTATTTGAAGGTGAGTAGCTGA No data
Right 1044751144 8:95416769-95416791 TACATCACCTCCACATGTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044751142 Original CRISPR TCAGCTACTCACCTTCAAAT AGG (reversed) Intergenic
No off target data available for this crispr