ID: 1044753672

View in Genome Browser
Species Human (GRCh38)
Location 8:95439891-95439913
Sequence TGTTCCTCGTTAGCTATGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044753672_1044753674 27 Left 1044753672 8:95439891-95439913 CCATACATAGCTAACGAGGAACA No data
Right 1044753674 8:95439941-95439963 ACTTTCCTGTGCAAGATCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044753672 Original CRISPR TGTTCCTCGTTAGCTATGTA TGG (reversed) Intergenic
No off target data available for this crispr