ID: 1044756577

View in Genome Browser
Species Human (GRCh38)
Location 8:95468736-95468758
Sequence CAGTTTTTGCAGCTTGTTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044756574_1044756577 5 Left 1044756574 8:95468708-95468730 CCTTGGCCATAATTAGTAAACTT No data
Right 1044756577 8:95468736-95468758 CAGTTTTTGCAGCTTGTTGTGGG No data
1044756575_1044756577 -1 Left 1044756575 8:95468714-95468736 CCATAATTAGTAAACTTGAAAAC No data
Right 1044756577 8:95468736-95468758 CAGTTTTTGCAGCTTGTTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044756577 Original CRISPR CAGTTTTTGCAGCTTGTTGT GGG Intergenic
No off target data available for this crispr