ID: 1044758723

View in Genome Browser
Species Human (GRCh38)
Location 8:95494200-95494222
Sequence CTCACCTAAAAAACTAATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044758723_1044758728 11 Left 1044758723 8:95494200-95494222 CCTCCATTAGTTTTTTAGGTGAG No data
Right 1044758728 8:95494234-95494256 TGAGATTCCTCCTACCCTTAGGG No data
1044758723_1044758727 10 Left 1044758723 8:95494200-95494222 CCTCCATTAGTTTTTTAGGTGAG No data
Right 1044758727 8:95494233-95494255 CTGAGATTCCTCCTACCCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044758723 Original CRISPR CTCACCTAAAAAACTAATGG AGG (reversed) Intergenic
No off target data available for this crispr