ID: 1044760223

View in Genome Browser
Species Human (GRCh38)
Location 8:95510103-95510125
Sequence CTCAGTGAACTCTACAAATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044760223_1044760228 26 Left 1044760223 8:95510103-95510125 CCACATTTGTAGAGTTCACTGAG No data
Right 1044760228 8:95510152-95510174 TCTTGGCTTGAGGCCGCAGACGG No data
1044760223_1044760225 -2 Left 1044760223 8:95510103-95510125 CCACATTTGTAGAGTTCACTGAG No data
Right 1044760225 8:95510124-95510146 AGAAAATGAGCTGGTAATGAAGG No data
1044760223_1044760227 16 Left 1044760223 8:95510103-95510125 CCACATTTGTAGAGTTCACTGAG No data
Right 1044760227 8:95510142-95510164 GAAGGCTCTTTCTTGGCTTGAGG No data
1044760223_1044760226 9 Left 1044760223 8:95510103-95510125 CCACATTTGTAGAGTTCACTGAG No data
Right 1044760226 8:95510135-95510157 TGGTAATGAAGGCTCTTTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044760223 Original CRISPR CTCAGTGAACTCTACAAATG TGG (reversed) Intergenic
No off target data available for this crispr