ID: 1044760275

View in Genome Browser
Species Human (GRCh38)
Location 8:95510409-95510431
Sequence TGGCCTCAGCCTAAAGCAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044760275_1044760285 22 Left 1044760275 8:95510409-95510431 CCCCCTGCTTTAGGCTGAGGCCA No data
Right 1044760285 8:95510454-95510476 CTCTCTCTTCACATTCTCCAGGG No data
1044760275_1044760286 30 Left 1044760275 8:95510409-95510431 CCCCCTGCTTTAGGCTGAGGCCA No data
Right 1044760286 8:95510462-95510484 TCACATTCTCCAGGGAGCCTAGG No data
1044760275_1044760284 21 Left 1044760275 8:95510409-95510431 CCCCCTGCTTTAGGCTGAGGCCA No data
Right 1044760284 8:95510453-95510475 TCTCTCTCTTCACATTCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044760275 Original CRISPR TGGCCTCAGCCTAAAGCAGG GGG (reversed) Intergenic
No off target data available for this crispr