ID: 1044761599

View in Genome Browser
Species Human (GRCh38)
Location 8:95523205-95523227
Sequence GCTGCATGTTCTGAACATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044761599_1044761605 27 Left 1044761599 8:95523205-95523227 CCAGCATGTTCAGAACATGCAGC No data
Right 1044761605 8:95523255-95523277 ATGCAGTTAGTCCTGACCAAAGG No data
1044761599_1044761602 -3 Left 1044761599 8:95523205-95523227 CCAGCATGTTCAGAACATGCAGC No data
Right 1044761602 8:95523225-95523247 AGCTTGGGTATCTTTCTCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044761599 Original CRISPR GCTGCATGTTCTGAACATGC TGG (reversed) Intergenic
No off target data available for this crispr