ID: 1044765494

View in Genome Browser
Species Human (GRCh38)
Location 8:95568577-95568599
Sequence ATCTTAAGCAAGAAGAACAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044765494_1044765495 -7 Left 1044765494 8:95568577-95568599 CCTTTGTTCTTCTTGCTTAAGAT No data
Right 1044765495 8:95568593-95568615 TTAAGATTGTTTTAGCTATTTGG No data
1044765494_1044765496 -6 Left 1044765494 8:95568577-95568599 CCTTTGTTCTTCTTGCTTAAGAT No data
Right 1044765496 8:95568594-95568616 TAAGATTGTTTTAGCTATTTGGG No data
1044765494_1044765497 -5 Left 1044765494 8:95568577-95568599 CCTTTGTTCTTCTTGCTTAAGAT No data
Right 1044765497 8:95568595-95568617 AAGATTGTTTTAGCTATTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044765494 Original CRISPR ATCTTAAGCAAGAAGAACAA AGG (reversed) Intergenic
No off target data available for this crispr