ID: 1044766703 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 8:95583637-95583659 |
| Sequence | CTAGGCTTGTCCTCTACTTG AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 4 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1044766700_1044766703 | 8 | Left | 1044766700 | 8:95583606-95583628 | CCAACCAATATTGCAAATGCAGC | No data | ||
| Right | 1044766703 | 8:95583637-95583659 | CTAGGCTTGTCCTCTACTTGAGG | No data | ||||
| 1044766698_1044766703 | 19 | Left | 1044766698 | 8:95583595-95583617 | CCTACCTTCTGCCAACCAATATT | No data | ||
| Right | 1044766703 | 8:95583637-95583659 | CTAGGCTTGTCCTCTACTTGAGG | No data | ||||
| 1044766699_1044766703 | 15 | Left | 1044766699 | 8:95583599-95583621 | CCTTCTGCCAACCAATATTGCAA | No data | ||
| Right | 1044766703 | 8:95583637-95583659 | CTAGGCTTGTCCTCTACTTGAGG | No data | ||||
| 1044766701_1044766703 | 4 | Left | 1044766701 | 8:95583610-95583632 | CCAATATTGCAAATGCAGCAGTC | No data | ||
| Right | 1044766703 | 8:95583637-95583659 | CTAGGCTTGTCCTCTACTTGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1044766703 | Original CRISPR | CTAGGCTTGTCCTCTACTTG AGG | Intergenic | ||