ID: 1044766703

View in Genome Browser
Species Human (GRCh38)
Location 8:95583637-95583659
Sequence CTAGGCTTGTCCTCTACTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044766700_1044766703 8 Left 1044766700 8:95583606-95583628 CCAACCAATATTGCAAATGCAGC No data
Right 1044766703 8:95583637-95583659 CTAGGCTTGTCCTCTACTTGAGG No data
1044766698_1044766703 19 Left 1044766698 8:95583595-95583617 CCTACCTTCTGCCAACCAATATT No data
Right 1044766703 8:95583637-95583659 CTAGGCTTGTCCTCTACTTGAGG No data
1044766699_1044766703 15 Left 1044766699 8:95583599-95583621 CCTTCTGCCAACCAATATTGCAA No data
Right 1044766703 8:95583637-95583659 CTAGGCTTGTCCTCTACTTGAGG No data
1044766701_1044766703 4 Left 1044766701 8:95583610-95583632 CCAATATTGCAAATGCAGCAGTC No data
Right 1044766703 8:95583637-95583659 CTAGGCTTGTCCTCTACTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044766703 Original CRISPR CTAGGCTTGTCCTCTACTTG AGG Intergenic