ID: 1044774519

View in Genome Browser
Species Human (GRCh38)
Location 8:95674407-95674429
Sequence TAGAGATACTTCAGTACCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044774516_1044774519 24 Left 1044774516 8:95674360-95674382 CCCTTTAGCCTGATATCTGGTGC No data
Right 1044774519 8:95674407-95674429 TAGAGATACTTCAGTACCCCAGG No data
1044774518_1044774519 16 Left 1044774518 8:95674368-95674390 CCTGATATCTGGTGCACTGAAAT No data
Right 1044774519 8:95674407-95674429 TAGAGATACTTCAGTACCCCAGG No data
1044774517_1044774519 23 Left 1044774517 8:95674361-95674383 CCTTTAGCCTGATATCTGGTGCA No data
Right 1044774519 8:95674407-95674429 TAGAGATACTTCAGTACCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044774519 Original CRISPR TAGAGATACTTCAGTACCCC AGG Intergenic
No off target data available for this crispr