ID: 1044776725

View in Genome Browser
Species Human (GRCh38)
Location 8:95697150-95697172
Sequence CTGTAGGCCCAAATGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044776720_1044776725 1 Left 1044776720 8:95697126-95697148 CCAGAAGAAAATGGAGTATTGTC No data
Right 1044776725 8:95697150-95697172 CTGTAGGCCCAAATGGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044776725 Original CRISPR CTGTAGGCCCAAATGGTGGA GGG Intergenic
No off target data available for this crispr