ID: 1044776725 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 8:95697150-95697172 |
| Sequence | CTGTAGGCCCAAATGGTGGA GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1044776720_1044776725 | 1 | Left | 1044776720 | 8:95697126-95697148 | CCAGAAGAAAATGGAGTATTGTC | No data | ||
| Right | 1044776725 | 8:95697150-95697172 | CTGTAGGCCCAAATGGTGGAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1044776725 | Original CRISPR | CTGTAGGCCCAAATGGTGGA GGG | Intergenic | ||
| No off target data available for this crispr | |||||