ID: 1044778485

View in Genome Browser
Species Human (GRCh38)
Location 8:95719373-95719395
Sequence GTTCAGCCCTTGAAATATAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044778485_1044778488 10 Left 1044778485 8:95719373-95719395 CCCTTATATTTCAAGGGCTGAAC No data
Right 1044778488 8:95719406-95719428 TAGACAAAACGGAGTAAGTTTGG No data
1044778485_1044778489 25 Left 1044778485 8:95719373-95719395 CCCTTATATTTCAAGGGCTGAAC No data
Right 1044778489 8:95719421-95719443 AAGTTTGGATTATAACTGTTTGG No data
1044778485_1044778487 -1 Left 1044778485 8:95719373-95719395 CCCTTATATTTCAAGGGCTGAAC No data
Right 1044778487 8:95719395-95719417 CACTTTGCATCTAGACAAAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044778485 Original CRISPR GTTCAGCCCTTGAAATATAA GGG (reversed) Intergenic
No off target data available for this crispr