ID: 1044780806

View in Genome Browser
Species Human (GRCh38)
Location 8:95741505-95741527
Sequence TGCTGCTCTACCTTATTAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044780804_1044780806 0 Left 1044780804 8:95741482-95741504 CCAAGATCTCTACTCAGCAATAC No data
Right 1044780806 8:95741505-95741527 TGCTGCTCTACCTTATTAGGTGG No data
1044780803_1044780806 1 Left 1044780803 8:95741481-95741503 CCCAAGATCTCTACTCAGCAATA No data
Right 1044780806 8:95741505-95741527 TGCTGCTCTACCTTATTAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044780806 Original CRISPR TGCTGCTCTACCTTATTAGG TGG Intergenic
No off target data available for this crispr