ID: 1044784110

View in Genome Browser
Species Human (GRCh38)
Location 8:95776667-95776689
Sequence CAGGAATTCCCCCAAGGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044784103_1044784110 16 Left 1044784103 8:95776628-95776650 CCTTGGGAGAAGAAAGGACAAAC No data
Right 1044784110 8:95776667-95776689 CAGGAATTCCCCCAAGGGGCTGG No data
1044784101_1044784110 24 Left 1044784101 8:95776620-95776642 CCTGGAGGCCTTGGGAGAAGAAA No data
Right 1044784110 8:95776667-95776689 CAGGAATTCCCCCAAGGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044784110 Original CRISPR CAGGAATTCCCCCAAGGGGC TGG Intergenic
No off target data available for this crispr